ZBTB45 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

ZBTB45 Polyclonal Antibody
ES8178-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ZBTB45 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

ZBTB45 Antibody
1-CSB-PA080144	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against ZBTB45. Recognizes ZBTB45 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:500-1000.IHC:1:200-500

Anti-ZBTB45 antibody
STJ97367	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to ZBTB45.

ZBTB45 siRNA
20-abx940211	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Anti-ZBTB45/Znf499 Antibody
A17674	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for ZBTB45 Antibody (ZBTB45) detection. Tested with WB, IHC in Human, Mouse, Rat.

ZBTB45 cloning plasmid
CSB-CL822240HU-10ug	Cusabio	10ug	EUR 539
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1536 Sequence: atggcggctgcagaggctgtgcatcacatacacctgcagaacttctcacgctctctgcttgagaccctcaatgggcagaggcttgggggacacttctgtgacgtgactgtgcgcattcgtgaagcttcgctgcgtgcccaccgctgcgtgctggcggccggctcacccttcttcc Show more
Description: A cloning plasmid for the ZBTB45 gene.

Human ZBTB45 ELISA KIT
ELI-17590h	Lifescience Market	96 Tests	EUR 824

Human ZBTB45 shRNA Plasmid
20-abx963659	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ZBTB45 Recombinant Protein (Rat)
RP237887	ABM	100 ug	Ask for price

pCMV-SPORT6-ZBTB45 Plasmid
PVT16291	Lifescience Market	2 ug	EUR 325

ZBTB45 Recombinant Protein (Human)
RP035167	ABM	100 ug	Ask for price

ZBTB45 Recombinant Protein (Mouse)
RP186257	ABM	100 ug	Ask for price

Zbtb45 ORF Vector (Mouse) (pORF)
ORF062087	ABM	1.0 ug DNA	EUR 506

Zbtb45 ORF Vector (Rat) (pORF)
ORF079297	ABM	1.0 ug DNA	EUR 506

ZBTB45 ORF Vector (Human) (pORF)
ORF011723	ABM	1.0 ug DNA	EUR 95

Zbtb45 sgRNA CRISPR Lentivector set (Rat)
K6481301	ABM	3 x 1.0 ug	EUR 339

ZBTB45 sgRNA CRISPR Lentivector set (Human)
K2663601	ABM	3 x 1.0 ug	EUR 339

Zbtb45 sgRNA CRISPR Lentivector set (Mouse)
K4737701	ABM	3 x 1.0 ug	EUR 339

Zinc Finger And BTB Domain Containing 45 (ZBTB45) Antibody
20-abx329770	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Zbtb45 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6481302	ABM	1.0 ug DNA	EUR 154

Zbtb45 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6481303	ABM	1.0 ug DNA	EUR 154

Zbtb45 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6481304	ABM	1.0 ug DNA	EUR 154

ZBTB45 sgRNA CRISPR Lentivector (Human) (Target 1)
K2663602	ABM	1.0 ug DNA	EUR 154

ZBTB45 sgRNA CRISPR Lentivector (Human) (Target 2)
K2663603	ABM	1.0 ug DNA	EUR 154

ZBTB45 sgRNA CRISPR Lentivector (Human) (Target 3)
K2663604	ABM	1.0 ug DNA	EUR 154

Zbtb45 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4737702	ABM	1.0 ug DNA	EUR 154

Zbtb45 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4737703	ABM	1.0 ug DNA	EUR 154

Zbtb45 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4737704	ABM	1.0 ug DNA	EUR 154

ZBTB45 Protein Vector (Mouse) (pPB-C-His)
PV248346	ABM	500 ng	EUR 603

ZBTB45 Protein Vector (Mouse) (pPB-N-His)
PV248347	ABM	500 ng	EUR 603

ZBTB45 Protein Vector (Mouse) (pPM-C-HA)
PV248348	ABM	500 ng	EUR 603

ZBTB45 Rabbit Polyclonal Antibody