ZBTB45 Rabbit Polyclonal Antibody

ZBTB45 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

ZBTB45 Polyclonal Antibody

ES8178-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ZBTB45 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

ZBTB45 Antibody

1-CSB-PA080144
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against ZBTB45. Recognizes ZBTB45 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:500-1000.IHC:1:200-500

Anti-ZBTB45 antibody

STJ97367 200 µl
EUR 197
Description: Rabbit polyclonal to ZBTB45.

ZBTB45 siRNA

20-abx940211
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-ZBTB45/Znf499 Antibody

A17674 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ZBTB45 Antibody (ZBTB45) detection. Tested with WB, IHC in Human, Mouse, Rat.

ZBTB45 cloning plasmid

CSB-CL822240HU-10ug 10ug
EUR 539
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1536
  • Sequence: atggcggctgcagaggctgtgcatcacatacacctgcagaacttctcacgctctctgcttgagaccctcaatgggcagaggcttgggggacacttctgtgacgtgactgtgcgcattcgtgaagcttcgctgcgtgcccaccgctgcgtgctggcggccggctcacccttcttcc
  • Show more
Description: A cloning plasmid for the ZBTB45 gene.

Human ZBTB45 ELISA KIT

ELI-17590h 96 Tests
EUR 824

Human ZBTB45 shRNA Plasmid

20-abx963659
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ZBTB45 Recombinant Protein (Rat)

RP237887 100 ug Ask for price

pCMV-SPORT6-ZBTB45 Plasmid

PVT16291 2 ug
EUR 325

ZBTB45 Recombinant Protein (Human)

RP035167 100 ug Ask for price

ZBTB45 Recombinant Protein (Mouse)

RP186257 100 ug Ask for price

Zbtb45 ORF Vector (Mouse) (pORF)

ORF062087 1.0 ug DNA
EUR 506

Zbtb45 ORF Vector (Rat) (pORF)

ORF079297 1.0 ug DNA
EUR 506

ZBTB45 ORF Vector (Human) (pORF)

ORF011723 1.0 ug DNA
EUR 95

Zbtb45 sgRNA CRISPR Lentivector set (Rat)

K6481301 3 x 1.0 ug
EUR 339

ZBTB45 sgRNA CRISPR Lentivector set (Human)

K2663601 3 x 1.0 ug
EUR 339

Zbtb45 sgRNA CRISPR Lentivector set (Mouse)

K4737701 3 x 1.0 ug
EUR 339

Zinc Finger And BTB Domain Containing 45 (ZBTB45) Antibody

20-abx329770
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Zbtb45 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6481302 1.0 ug DNA
EUR 154

Zbtb45 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6481303 1.0 ug DNA
EUR 154

Zbtb45 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6481304 1.0 ug DNA
EUR 154

ZBTB45 sgRNA CRISPR Lentivector (Human) (Target 1)

K2663602 1.0 ug DNA
EUR 154

ZBTB45 sgRNA CRISPR Lentivector (Human) (Target 2)

K2663603 1.0 ug DNA
EUR 154

ZBTB45 sgRNA CRISPR Lentivector (Human) (Target 3)

K2663604 1.0 ug DNA
EUR 154

Zbtb45 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4737702 1.0 ug DNA
EUR 154

Zbtb45 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4737703 1.0 ug DNA
EUR 154

Zbtb45 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4737704 1.0 ug DNA
EUR 154

ZBTB45 Protein Vector (Mouse) (pPB-C-His)

PV248346 500 ng
EUR 603

ZBTB45 Protein Vector (Mouse) (pPB-N-His)

PV248347 500 ng
EUR 603

ZBTB45 Protein Vector (Mouse) (pPM-C-HA)

PV248348 500 ng
EUR 603

ZBTB45 Rabbit Polyclonal Antibody