MUM1 Rabbit Polyclonal Antibody

MUM1 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

MUM1 Polyclonal Antibody

ABP57478-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from MUM1 at AA range: 661-710
  • Applications tips:
Description: A polyclonal antibody for detection of MUM1 from Human, Mouse, Rat. This MUM1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from MUM1 at AA range: 661-710

MUM1 Polyclonal Antibody

ABP57478-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from MUM1 at AA range: 661-710
  • Applications tips:
Description: A polyclonal antibody for detection of MUM1 from Human, Mouse, Rat. This MUM1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from MUM1 at AA range: 661-710

MUM1 Polyclonal Antibody

ABP57478-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from MUM1 at AA range: 661-710
  • Applications tips:
Description: A polyclonal antibody for detection of MUM1 from Human, Mouse, Rat. This MUM1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from MUM1 at AA range: 661-710

MUM1 Antibody

BF0505 200ul
EUR 376
Description: MUM1 antibody detects endogenous levels of total MUM1.

MUM1 Antibody

48448-100ul 100ul
EUR 333

MUM1 Antibody

48448-50ul 50ul
EUR 239

MUM1 antibody

10R-2189 100 ul
EUR 403
Description: Mouse monoclonal MUM1 antibody

MUM1 antibody

70R-18681 50 ul
EUR 435
Description: Rabbit polyclonal MUM1 antibody

MUM1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MUM1. Recognizes MUM1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

MUM1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MUM1. Recognizes MUM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PWWP Domain-Containing Protein MUM1 (MUM1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

PWWP Domain-Containing Protein MUM1 (MUM1) Antibody

abx011207-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

PWWP Domain-Containing Protein MUM1 (MUM1) Antibody

abx029726-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

PWWP Domain-Containing Protein MUM1 (MUM1) Antibody

abx029726-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

PWWP domain-containing protein MUM1 (MUM1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

PWWP Domain-Containing Protein MUM1 (MUM1) Antibody

abx235437-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

MUM1 Conjugated Antibody

C48448 100ul
EUR 397

anti- MUM1 antibody

FNab05437 100µg
EUR 585
  • Immunogen: melanoma associated antigen(mutated) 1
  • Uniprot ID: Q2TAK8
  • Gene ID: 84939
  • Research Area: Cancer, Immunology, Cell Division and Proliferation
Description: Antibody raised against MUM1

Anti-MUM1 Antibody

A02544 100 ug
EUR 397
Description: Rabbit Polyclonal MUM1 Antibody. Validated in WB and tested in Human.

Anti-MUM1 Antibody

A02544-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for MUM1 Antibody (MUM1) detection. Tested with WB in Human, Mouse, Rat.

Anti-MUM1 antibody

PAab05437 100 ug
EUR 412

Anti-MUM1 antibody

STJ98258 100 µl
EUR 234
Description: Mouse monoclonal to MUM1.

Anti-MUM1 antibody

STJ98584 200 µl
EUR 197
Description: Rabbit polyclonal to MUM1.

Anti-MUM1 antibody

STJ180184 0.1 ml
EUR 212

Mum1/ Rat Mum1 ELISA Kit

ELI-03757r 96 Tests
EUR 886

Anti-MUM1/IRF4 Rabbit Monoclonal Antibody (RM352)

EUR 321


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA21531 50 ug
EUR 363
Description: Mouse polyclonal to MUM1


YF-PA24008 50 ul
EUR 334
Description: Mouse polyclonal to MUM1

Anti-MUM1/IRF4 Rabbit Monoclonal Antibody, Clone#RM352

M00401-1 100uL
EUR 397
Description: Anti-MUM1/IRF4 Rabbit Monoclonal Antibody, Clone#RM352 tested in WB, IHC, reactive to Human

Anti-MUM1/IRF4 Antibody

PB9222 100ug/vial
EUR 334

Anti-MUM1 Monoclonal Antibody

M00401 100ug
EUR 397
Description: Rabbit Monoclonal MUM1 Antibody. Validated in IP, IF, WB and tested in Human.

Anti-Human MUM1 antibody

STJ16100401 1 mL
EUR 1229

Anti-Human MUM1 antibody

STJ16100460 1 mL
EUR 1020

MUM1 Blocking Peptide

BF0505-BP 1mg
EUR 195

MUM1 cloning plasmid

CSB-CL648777HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 570
  • Sequence: atgtccagggttccagggcccggtggcctgggagctgctttctccccactggctgggctgcatctggccctggctggaggccttgctttgaggggctgtgaccctcttcccccaggccctccccagccgacgacagccaccggagaggagatcggaacacgattgtctcagatgca
  • Show more
Description: A cloning plasmid for the MUM1 gene.

MUM1 cloning plasmid

CSB-CL648777HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 459
  • Sequence: atgctccccgaccgctcgcgggccgcccgggaccgggccaaccagaagctggtggagtacattgtgaaggccaagggcgcggagagccacctgcgggccatcctaaagagcaggaagccatctcgctggctgcagaccttcctgagctccagccagtacgtgacctgtgtggagac
  • Show more
Description: A cloning plasmid for the MUM1 gene.

MUM1 cloning plasmid

CSB-CL648777HU3-10ug 10ug
EUR 650
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1929
  • Sequence: atggtcagtgcctcacagaatgaggttcctgcggcacccctggaagaactggcctacagacggtcgcttcgcgtggctctggacgttctgagcgagggctcgatttggagtcaagaaagctctgcagggacaggtagagctgaccggtctctgcgagggaagcccatggagcatg
  • Show more
Description: A cloning plasmid for the MUM1 gene.

anti-MUM1 (4G10)

LF-MA30395 100 ul
EUR 486
Description: Mouse Monoclonal to MUM1

Anti-MUM1 (3A10)

YF-MA13854 100 ug
EUR 363
Description: Mouse monoclonal to MUM1

Anti-MUM1 (2D1)

YF-MA13855 100 ug
EUR 363
Description: Mouse monoclonal to MUM1

Anti-MUM1 (3C4)

YF-MA13856 100 ug
EUR 363
Description: Mouse monoclonal to MUM1

Monoclonal MUM1 Antibody, Clone: 4G10

AMM02768G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human MUM1. The antibodies are raised in Mouse and are from clone 4G10. This antibody is applicable in WB and IHC, E

MUM1 Like 1 (MUM1L1) Antibody

abx028468-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

MUM1 Like 1 (MUM1L1) Antibody

abx028468-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

MUM1 Like 1 (MUM1L1) Antibody

abx235438-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Cow PWWP domain-containing protein MUM1 (MUM1) ELISA Kit

abx515429-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse PWWP domain-containing protein MUM1 (MUM1) ELISA Kit

abx515431-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat PWWP domain-containing protein MUM1 (MUM1) ELISA Kit

abx515432-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human MUM1/ PWWP domain-containing protein MUM1 ELISA Kit

E1677Hu 1 Kit
EUR 571

Human MUM1(PWWP domain-containing protein MUM1) ELISA Kit

EH1301 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q2TAK8
  • Alias: MUM1(Mutated melanoma-associated antigen 1)/LSIRF/NF-EM5/interferon regulatory factor 4/IRF-4/Lymphocyte-specific interferon regulatory factor/Multiple myeloma oncogene 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Bovine PWWP domain- containing protein MUM1, MUM1 ELISA KIT

ELI-03758b 96 Tests
EUR 928

Human PWWP domain- containing protein MUM1, MUM1 ELISA KIT

ELI-03759h 96 Tests
EUR 824

Mouse PWWP domain- containing protein MUM1, Mum1 ELISA KIT

ELI-03760m 96 Tests
EUR 865

Human PWWP domain-containing protein MUM1 (MUM1) ELISA Kit

abx250566-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse MUM1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat MUM1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MUM1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MUM1 ELISA Kit

ELA-E1142h 96 Tests
EUR 824


EF003645 96 Tests
EUR 689

MUM1 Recombinant Protein (Human)

RP020401 100 ug Ask for price

MUM1 Recombinant Protein (Human)

RP020404 100 ug Ask for price

MUM1 Recombinant Protein (Human)

RP041482 100 ug Ask for price

MUM1 Recombinant Protein (Rat)

RP212792 100 ug Ask for price

MUM1 Recombinant Protein (Mouse)

RP152273 100 ug Ask for price

Monoclonal MUM1 Antibody (clone 4G10), Clone: 4G10

AMM01897G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human MUM1 (clone 4G10). The antibodies are raised in Mouse and are from clone 4G10. This antibody is applicable in WB and IHC-P, E

MUM1 ORF Vector (Human) (pORF)

ORF006801 1.0 ug DNA
EUR 95

MUM1 ORF Vector (Human) (pORF)

ORF006802 1.0 ug DNA
EUR 95

Mum1 ORF Vector (Mouse) (pORF)

ORF050759 1.0 ug DNA
EUR 506

Mum1 ORF Vector (Rat) (pORF)

ORF070932 1.0 ug DNA
EUR 506

MUM1 ORF Vector (Human) (pORF)

ORF013828 1.0 ug DNA
EUR 354

MUM1 ELISA Kit (Human) (OKEH04636)

OKEH04636 96 Wells
EUR 662
Description: Description of target: Involved in the DNA damage response pathway by contributing to the maintenance of chromatin architecture. Recruited to the vicinity of DNA breaks by TP53BP1 and plays an accessory role to facilitate damage-induced chromatin changes and promoting chromatin relaxation. Required for efficient DNA repair and cell survival following DNA damage.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 32 pg/mL

MUM1 ELISA Kit (Mouse) (OKEH05655)

OKEH05655 96 Wells
EUR 662
Description: Description of target: Involved in the DNA damage response pathway by contributing to the maintenance of chromatin architecture. Recruited to the vicinity of DNA breaks by TP53BP1 and plays an accessory role to facilitate damage-induced chromatin changes and promoting chromatin relaxation. Required for efficient DNA repair and cell survival following DNA damage.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.1 pg/mL

MUM1 ELISA Kit (Rat) (OKEH06222)

OKEH06222 96 Wells
EUR 662
Description: Description of target: Involved in the DNA damage response pathway by contributing to the maintenance of chromatin architecture. Recruited to the vicinity of DNA breaks by TP53BP1 and plays an accessory role to facilitate damage-induced chromatin changes and promoting chromatin relaxation. Required for efficient DNA repair and cell survival following DNA damage.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.2 pg/mL

Mouse Anti-Human MUM1 monoclonal antibody, clone JID738

CABT-L2922-100uL500uL 100 uL, 500 uL
EUR 502

MUM1 sgRNA CRISPR Lentivector set (Human)

K1368601 3 x 1.0 ug
EUR 339

Mum1 sgRNA CRISPR Lentivector set (Mouse)

K4925301 3 x 1.0 ug
EUR 339

Mum1 sgRNA CRISPR Lentivector set (Rat)

K6604801 3 x 1.0 ug
EUR 339

Human MUM1 Like 1 (MUM1L1) ELISA Kit

abx381616-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

MUM1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1368602 1.0 ug DNA
EUR 154

MUM1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1368603 1.0 ug DNA
EUR 154

MUM1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1368604 1.0 ug DNA
EUR 154

Mum1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4925302 1.0 ug DNA
EUR 154

Mum1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4925303 1.0 ug DNA
EUR 154

Mum1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4925304 1.0 ug DNA
EUR 154

Mum1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6604802 1.0 ug DNA
EUR 154

Mum1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6604803 1.0 ug DNA
EUR 154

Mum1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6604804 1.0 ug DNA
EUR 154

MUM1 Protein Vector (Human) (pPB-C-His)

PV055309 500 ng
EUR 481

MUM1 Protein Vector (Human) (pPB-N-His)

PV055310 500 ng
EUR 481

MUM1 Protein Vector (Human) (pPM-C-HA)

PV055311 500 ng
EUR 481

MUM1 Protein Vector (Human) (pPM-C-His)

PV055312 500 ng
EUR 481

MUM1 Protein Vector (Rat) (pPB-C-His)

PV283726 500 ng
EUR 1166

MUM1 Protein Vector (Rat) (pPB-N-His)

PV283727 500 ng
EUR 1166

MUM1 Protein Vector (Rat) (pPM-C-HA)

PV283728 500 ng
EUR 1166

MUM1 Protein Vector (Rat) (pPM-C-His)

PV283729 500 ng
EUR 1166

MUM1 Protein Vector (Human) (pPB-C-His)

PV027201 500 ng
EUR 329

MUM1 Protein Vector (Human) (pPB-N-His)

PV027202 500 ng
EUR 329

MUM1 Protein Vector (Human) (pPM-C-HA)

PV027203 500 ng
EUR 329

MUM1 Protein Vector (Human) (pPM-C-His)

PV027204 500 ng
EUR 329

MUM1 Protein Vector (Human) (pPB-C-His)

PV027205 500 ng
EUR 329

MUM1 Protein Vector (Human) (pPB-N-His)

PV027206 500 ng
EUR 329

MUM1 Protein Vector (Human) (pPM-C-HA)

PV027207 500 ng
EUR 329

MUM1 Protein Vector (Human) (pPM-C-His)

PV027208 500 ng
EUR 329

MUM1 Protein Vector (Mouse) (pPB-C-His)

PV203034 500 ng
EUR 1065

MUM1 Protein Vector (Mouse) (pPB-N-His)

PV203035 500 ng
EUR 1065

MUM1 Protein Vector (Mouse) (pPM-C-HA)

PV203036 500 ng
EUR 1065

MUM1 Protein Vector (Mouse) (pPM-C-His)

PV203037 500 ng
EUR 1065

Mum1 3'UTR GFP Stable Cell Line

TU163631 1.0 ml Ask for price

Mum1 3'UTR Luciferase Stable Cell Line

TU213573 1.0 ml Ask for price

MUM1 3'UTR Luciferase Stable Cell Line

TU014979 1.0 ml
EUR 1521

Mum1 3'UTR Luciferase Stable Cell Line

TU113631 1.0 ml Ask for price

MUM1 3'UTR GFP Stable Cell Line

TU064979 1.0 ml
EUR 1521

Mum1 3'UTR GFP Stable Cell Line

TU263573 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MUM1 Rabbit Polyclonal Antibody