TRAF1 Rabbit Polyclonal Antibody

TRAF1 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

TRAF1 Polyclonal Antibody
ES8493-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRAF1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
TRAF1 Polyclonal Antibody
ABP57500-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from TRAF1 at AA range: 191-240
  • Applications tips:
Description: A polyclonal antibody for detection of TRAF1 from Human, Mouse. This TRAF1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from TRAF1 at AA range: 191-240
TRAF1 Polyclonal Antibody
ABP57500-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from TRAF1 at AA range: 191-240
  • Applications tips:
Description: A polyclonal antibody for detection of TRAF1 from Human, Mouse. This TRAF1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from TRAF1 at AA range: 191-240
TRAF1 Polyclonal Antibody
ABP57500-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from TRAF1 at AA range: 191-240
  • Applications tips:
Description: A polyclonal antibody for detection of TRAF1 from Human, Mouse. This TRAF1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from TRAF1 at AA range: 191-240
TRAF1 Rabbit pAb
A0150-100ul 100 ul
EUR 308
TRAF1 Rabbit pAb
A0150-200ul 200 ul
EUR 459
TRAF1 Rabbit pAb
A0150-20ul 20 ul
EUR 183
TRAF1 Rabbit pAb
A0150-50ul 50 ul
EUR 223
TRAF1 Rabbit pAb
A12340-100ul 100 ul
EUR 308
TRAF1 Rabbit pAb
A12340-200ul 200 ul
EUR 459
TRAF1 Rabbit pAb
A12340-20ul 20 ul
EUR 183
TRAF1 Rabbit pAb
A12340-50ul 50 ul
EUR 223
TRAF1 Antibody
AF5396 200ul
EUR 304
Description: TRAF1 Antibody detects endogenous levels of total TRAF1.
TRAF1 Antibody
ABF5396 100 ug
EUR 438
TRAF1 antibody
70R-20954 50 ul
EUR 435
Description: Rabbit polyclonal TRAF1 antibody
TRAF1 Antibody
35967-100ul 100ul
EUR 252
TRAF1 antibody
70R-10512 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TRAF1 antibody
TRAF1 Antibody
1-CSB-PA436548
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRAF1. Recognizes TRAF1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100
TRAF1 Antibody
1-CSB-PA445195
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRAF1. Recognizes TRAF1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50
TRAF1 Antibody
1-CSB-PA118746
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TRAF1. Recognizes TRAF1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000
TRAF1 Antibody
1-CSB-PA024146GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TRAF1. Recognizes TRAF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
TRAF1 antibody
PAab10063 100 ug
EUR 386
Polyclonal TRAF1 Antibody (C-Terminus)
APG03013G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TRAF1 (C-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal Goat Anti-TRAF1 Antibody
APG00344G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-TRAF1 . This antibody is tested and proven to work in the following applications:
TRAF1 Conjugated Antibody
C35967 100ul
EUR 397
anti- TRAF1 antibody
FNab08916 100µg
EUR 548.75
  • Immunogen: TNF receptor-associated factor 1
  • Uniprot ID: Q13077
  • Gene ID: 7185
  • Research Area: Immunology, Signal Transduction, Metabolism
Description: Antibody raised against TRAF1
anti- TRAF1 antibody
FNab10063 100µg
EUR 548.75
  • Recommended dilution: IHC: 1:20-1:200
  • Immunogen: TNF receptor-associated factor 1
  • Uniprot ID: Q13077
  • Gene ID: 26146
  • Research Area: Immunology, Signal Transduction, Metabolism
Description: Antibody raised against TRAF1
Human TRAF1 Antibody
32987-05111 150 ug
EUR 261
Anti-TRAF1 antibody
PAab08916 100 ug
EUR 386
Anti-TRAF1 Antibody
PA2006 100ug/vial
EUR 294
Anti-TRAF1 antibody
STJ70886 100 µg
EUR 359
Anti-TRAF1 antibody
STJ98606 200 µl
EUR 197
Description: Rabbit polyclonal to TRAF1.
Anti-TRAF1 antibody
STJ25950 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the TNF receptor (TNFR) associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from various receptors of the TNFR superfamily. This protein and TRAF2 form a heterodimeric complex, which is required for TNF-alpha-mediated activation of MAPK8/JNK and NF-kappaB. The protein complex formed by this protein and TRAF2 also interacts with inhibitor-of-apoptosis proteins (IAPs), and thus mediates the anti-apoptotic signals from TNF receptors. The expression of this protein can be induced by Epstein-Barr virus (EBV). EBV infection membrane protein 1 (LMP1) is found to interact with this and other TRAF proteins; this interaction is thought to link LMP1-mediated B lymphocyte transformation to the signal transduction from TNFR family receptors. Three transcript variants encoding two different isoforms have been found for this gene.
Anti-TRAF1 antibody
STJ114220 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the TNF receptor (TNFR) associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from various receptors of the TNFR superfamily. This protein and TRAF2 form a heterodimeric complex, which is required for TNF-alpha-mediated activation of MAPK8/JNK and NF-kappaB. The protein complex formed by this protein and TRAF2 also interacts with inhibitor-of-apoptosis proteins (IAPs), and thus mediates the anti-apoptotic signals from TNF receptors. The expression of this protein can be induced by Epstein-Barr virus (EBV). EBV infection membrane protein 1 (LMP1) is found to interact with this and other TRAF proteins; this interaction is thought to link LMP1-mediated B lymphocyte transformation to the signal transduction from TNFR family receptors. Three transcript variants encoding two different isoforms have been found for this gene.
TRAF1 siRNA
20-abx937902
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRAF1 siRNA
20-abx937903
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-TRAF1
YF-PA15114 50 ul
EUR 363
Description: Mouse polyclonal to TRAF1
anti-TRAF1
YF-PA15115 50 ug
EUR 363
Description: Mouse polyclonal to TRAF1
anti-TRAF1
YF-PA15116 100 ul
EUR 403
Description: Rabbit polyclonal to TRAF1
anti-TRAF1
YF-PA15117 100 ug
EUR 403
Description: Rabbit polyclonal to TRAF1
TRAF1 Blocking Peptide
AF5396-BP 1mg
EUR 195
TRAF1 cloning plasmid
CSB-CL024146HU-10ug 10ug
EUR 460
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1251
  • Sequence: atggcctccagctcaggcagcagtcctcgcccggcccctgatgagaatgagtttccctttgggtgccctcccaccgtctgccaggacccaaaggagcccagggctctctgctgtgcaggctgtctctctgagaacccgaggaatggcgaggatcagatctgccccaaatgcagag
  • Show more
Description: A cloning plasmid for the TRAF1 gene.
TRAF1 Blocking Peptide
33R-1850 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRAF1 antibody, catalog no. 70R-10512
Recombinant human TRAF1
P1159 100ug Ask for price
  • Uniprot ID: Q13077
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human TRAF1
Anti-TRAF1 (1A6)
YF-MA15936 100 ug
EUR 363
Description: Mouse monoclonal to TRAF1
Human TRAF1 Antibody (Biotin Conjugate)
32987-05121 150 ug
EUR 369
TNF Receptor Associated Factor 1 (TRAF1) Polyclonal Antibody (Human)
4-PAG070Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF1 (Gly131~Ala381)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 1 (TRAF1)
TNF Receptor Associated Factor 1 (TRAF1) Polyclonal Antibody (Mouse)
4-PAG070Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF1 (Leu169~Ala392)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse TNF Receptor Associated Factor 1 (TRAF1)
TRAF1 ELISA KIT|Human
EF003778 96 Tests
EUR 689
Human TRAF1 shRNA Plasmid
20-abx954934
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TRAF1 protein (His tag)
80R-1335 100 ug
EUR 268
Description: Purified recombinant Human TRAF1 protein
Mouse TRAF1 shRNA Plasmid
20-abx973205
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TRAF1 Recombinant Protein (Human)
RP032752 100 ug Ask for price
TRAF1 Recombinant Protein (Mouse)
RP180827 100 ug Ask for price
Anti-TRAF1 (2G9-G10)
YF-MA15935 100 ug
EUR 363
Description: Mouse monoclonal to TRAF1
Human TRAF1 AssayLite Antibody (FITC Conjugate)
32987-05141 150 ug
EUR 428
Human TRAF1 AssayLite Antibody (RPE Conjugate)
32987-05151 150 ug
EUR 428
Human TRAF1 AssayLite Antibody (APC Conjugate)
32987-05161 150 ug
EUR 428
Human TRAF1 AssayLite Antibody (PerCP Conjugate)
32987-05171 150 ug
EUR 471
TNF Receptor Associated Factor 1 (TRAF1) Polyclonal Antibody (Human), APC
4-PAG070Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF1 (Gly131~Ala381)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 1 (TRAF1). This antibody is labeled with APC.
TNF Receptor Associated Factor 1 (TRAF1) Polyclonal Antibody (Human), Biotinylated
4-PAG070Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF1 (Gly131~Ala381)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 1 (TRAF1). This antibody is labeled with Biotin.
TNF Receptor Associated Factor 1 (TRAF1) Polyclonal Antibody (Human), Cy3
4-PAG070Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF1 (Gly131~Ala381)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 1 (TRAF1). This antibody is labeled with Cy3.
TNF Receptor Associated Factor 1 (TRAF1) Polyclonal Antibody (Human), FITC
4-PAG070Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF1 (Gly131~Ala381)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 1 (TRAF1). This antibody is labeled with FITC.
TNF Receptor Associated Factor 1 (TRAF1) Polyclonal Antibody (Human), HRP
4-PAG070Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF1 (Gly131~Ala381)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 1 (TRAF1). This antibody is labeled with HRP.
TNF Receptor Associated Factor 1 (TRAF1) Polyclonal Antibody (Human), PE
4-PAG070Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF1 (Gly131~Ala381)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 1 (TRAF1). This antibody is labeled with PE.
TNF Receptor Associated Factor 1 (TRAF1) Polyclonal Antibody (Mouse), APC
4-PAG070Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF1 (Leu169~Ala392)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse TNF Receptor Associated Factor 1 (TRAF1). This antibody is labeled with APC.
TNF Receptor Associated Factor 1 (TRAF1) Polyclonal Antibody (Mouse), Biotinylated
4-PAG070Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF1 (Leu169~Ala392)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse TNF Receptor Associated Factor 1 (TRAF1). This antibody is labeled with Biotin.
TNF Receptor Associated Factor 1 (TRAF1) Polyclonal Antibody (Mouse), Cy3
4-PAG070Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF1 (Leu169~Ala392)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse TNF Receptor Associated Factor 1 (TRAF1). This antibody is labeled with Cy3.
TNF Receptor Associated Factor 1 (TRAF1) Polyclonal Antibody (Mouse), FITC
4-PAG070Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF1 (Leu169~Ala392)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse TNF Receptor Associated Factor 1 (TRAF1). This antibody is labeled with FITC.
TNF Receptor Associated Factor 1 (TRAF1) Polyclonal Antibody (Mouse), HRP
4-PAG070Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF1 (Leu169~Ala392)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse TNF Receptor Associated Factor 1 (TRAF1). This antibody is labeled with HRP.
TNF Receptor Associated Factor 1 (TRAF1) Polyclonal Antibody (Mouse), PE
4-PAG070Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF1 (Leu169~Ala392)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse TNF Receptor Associated Factor 1 (TRAF1). This antibody is labeled with PE.
TNF Receptor Associated Factor 1 (TRAF1) Polyclonal Antibody (Human), APC-Cy7
4-PAG070Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF1 (Gly131~Ala381)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 1 (TRAF1). This antibody is labeled with APC-Cy7.
TNF Receptor Associated Factor 1 (TRAF1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAG070Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF1 (Leu169~Ala392)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse TNF Receptor Associated Factor 1 (TRAF1). This antibody is labeled with APC-Cy7.
TNF Receptor-Associated Factor 1 (TRAF1) Antibody
20-abx126731
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
TNF Receptor-Associated Factor 1 (TRAF1) Antibody
20-abx116112
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
TNF Receptor-Associated Factor 1 (TRAF1) Antibody
20-abx116118
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
TNF Receptor Associated Factor 1 (TRAF1) Antibody
20-abx130985
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
TNF Receptor-Associated Factor 1 (TRAF1) Antibody
20-abx000575
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
TNF Receptor-Associated Factor 1 (TRAF1) Antibody
abx145544-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
TNF Receptor Associated Factor 1 (TRAF1) Antibody
20-abx103541
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
TNF Receptor Associated Factor 1 (TRAF1) Antibody
20-abx326261
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
TNF Receptor-Associated Factor 1 (TRAF1) Antibody
abx431683-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
TNF Receptor-Associated Factor 1 (TRAF1) Antibody
abx238916-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
TNF Receptor Associated Factor 1 (TRAF1) Antibody
20-abx211715
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
TNF Receptor Associated Factor 1 (TRAF1) Antibody
20-abx211800
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
TRAF1 ORF Vector (Human) (pORF)
ORF010918 1.0 ug DNA
EUR 95
Traf1 ORF Vector (Mouse) (pORF)
ORF060277 1.0 ug DNA
EUR 506
TRAF1 ELISA Kit (Human) (OKCA01573)
OKCA01573 96 Wells
EUR 930
Description: Description of target: Adapter molecule that regulates the activation of NF-kappa-B and JNK. Plays a role in the regulation of cell survival and apoptosis. The heterotrimer formed by TRAF1 and TRAF2 is part of a E3 ubiquitin-protein ligase complex that promotes ubiquitination of target proteins, such as MAP3K14. The TRAF1/TRAF2 complex recruits the antiapoptotic E3 protein-ubiquitin ligases BIRC2 and BIRC3 to TNFRSF1B/TNFR2.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.8 pg/mL
TRAF1 sgRNA CRISPR Lentivector set (Human)
K2432601 3 x 1.0 ug
EUR 339
Traf1 sgRNA CRISPR Lentivector set (Mouse)
K3870501 3 x 1.0 ug
EUR 339
TRAF1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2432602 1.0 ug DNA
EUR 154
TRAF1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2432603 1.0 ug DNA
EUR 154
TRAF1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2432604 1.0 ug DNA
EUR 154
Traf1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3870502 1.0 ug DNA
EUR 154
Traf1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3870503 1.0 ug DNA
EUR 154
Traf1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3870504 1.0 ug DNA
EUR 154
TRAF1 Protein Vector (Human) (pPB-C-His)
PV043669 500 ng
EUR 329
TRAF1 Protein Vector (Human) (pPB-N-His)
PV043670 500 ng
EUR 329
TRAF1 Protein Vector (Human) (pPM-C-HA)
PV043671 500 ng
EUR 329
TRAF1 Protein Vector (Human) (pPM-C-His)
PV043672 500 ng
EUR 329
Recombinant TNF Receptor Associated Factor 1 (TRAF1)
4-RPG070Hu01
  • EUR 266.66
  • EUR 174.00
  • EUR 724.96
  • EUR 308.32
  • EUR 516.64
  • EUR 241.00
  • EUR 1662.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q13077
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 58.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human TNF Receptor Associated Factor 1 expressed in: E.coli
Recombinant TNF Receptor Associated Factor 1 (TRAF1)
4-RPG070Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P39428
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.3kDa
  • Isoelectric Point: 9
Description: Recombinant Mouse TNF Receptor Associated Factor 1 expressed in: E.coli
pPLK/GFP+Puro-TRAF1 shRNA-1 Plasmid
PVTB01003-3a 2 ug
EUR 356
Recombinant Human TRAF1 Protein, His, E.coli-1mg
QP13802-1mg 1mg
EUR 2312
Recombinant Human TRAF1 Protein, His, E.coli-25ug
QP13802-25ug 25ug
EUR 201
Recombinant Human TRAF1 Protein, His, E.coli-5ug
QP13802-5ug 5ug
EUR 155
TRAF1 Protein Vector (Mouse) (pPB-C-His)
PV241106 500 ng
EUR 603
TRAF1 Protein Vector (Mouse) (pPB-N-His)
PV241107 500 ng
EUR 603
TRAF1 Protein Vector (Mouse) (pPM-C-HA)
PV241108 500 ng
EUR 603
TRAF1 Protein Vector (Mouse) (pPM-C-His)
PV241109 500 ng
EUR 603
Traf1 3'UTR GFP Stable Cell Line
TU171017 1.0 ml Ask for price
TRAF1 3'UTR GFP Stable Cell Line
TU076206 1.0 ml
EUR 1521
Traf1 3'UTR Luciferase Stable Cell Line
TU121017 1.0 ml Ask for price
TRAF1 3'UTR Luciferase Stable Cell Line
TU026206 1.0 ml
EUR 1521
Human TNF Receptor Associated Factor 1 (TRAF1) Protein
20-abx650678
  • EUR 356.00
  • EUR 217.00
  • EUR 996.00
  • EUR 439.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse TNF Receptor Associated Factor 1 (TRAF1) Protein
20-abx069346
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

TRAF1 Rabbit Polyclonal Antibody