AMBRA1 Rabbit Polyclonal Antibody

AMBRA1 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

Polyclonal Ambra1 Antibody
APG01849G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Ambra1 . This antibody is tested and proven to work in the following applications:
AMBRA1 Polyclonal Antibody
ES8480-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AMBRA1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
AMBRA1 Polyclonal Antibody
ES8480-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AMBRA1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
AMBRA1 Polyclonal Antibody
ABP57487-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide of AMBRA1
  • Applications tips:
Description: A polyclonal antibody for detection of AMBRA1 from Human, Mouse. This AMBRA1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of AMBRA1
AMBRA1 Polyclonal Antibody
ABP57487-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide of AMBRA1
  • Applications tips:
Description: A polyclonal antibody for detection of AMBRA1 from Human, Mouse. This AMBRA1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of AMBRA1
AMBRA1 Polyclonal Antibody
ABP57487-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide of AMBRA1
  • Applications tips:
Description: A polyclonal antibody for detection of AMBRA1 from Human, Mouse. This AMBRA1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of AMBRA1
Rabbit Anti Ambra1 (C-Terminal) Polyclonal Antibody
CPBT-66429RA 50 µg
EUR 533
Rabbit Anti Ambra1 (C-Terminal) Polyclonal Antibody
CPBT-66430RA 0.1 mg
EUR 663
Rabbit Anti Ambra1 (N-Terminal) Polyclonal Antibody
CPBT-66432RA 0.1 mg
EUR 663
AMBRA1 Rabbit pAb
A12578-100ul 100 ul
EUR 308
AMBRA1 Rabbit pAb
A12578-200ul 200 ul
EUR 459
AMBRA1 Rabbit pAb
A12578-20ul 20 ul
EUR 183
AMBRA1 Rabbit pAb
A12578-50ul 50 ul
EUR 223
AMBRA1 Antibody
ABD6228 100 ug
EUR 438
AMBRA1 Antibody
36091-100ul 100ul
EUR 252
AMBRA1 antibody
38182-100ul 100ul
EUR 252
Ambra1 Antibody
24666-100ul 100ul
EUR 390
Ambra1 Antibody
24667-100ul 100ul
EUR 390
AMBRA1 antibody
70R-15693 50 ul
EUR 435
Description: Rabbit polyclonal AMBRA1 antibody
AMBRA1 Antibody
DF6228 200ul
EUR 304
Description: AMBRA1 Antibody detects endogenous levels of total AMBRA1.
AMBRA1 Antibody
1-CSB-PA883655ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against AMBRA1. Recognizes AMBRA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
AMBRA1 Antibody
1-CSB-PA927593
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AMBRA1. Recognizes AMBRA1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
AMBRA1 Antibody
1-CSB-PA001655GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against AMBRA1. Recognizes AMBRA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
AMBRA1 Antibody
1-CSB-PA163788
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AMBRA1. Recognizes AMBRA1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
Polyclonal AMBRA1 Antibody (aa1-50)
APG01850G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AMBRA1 (aa1-50). This antibody is tested and proven to work in the following applications:
Polyclonal AMBRA1 Antibody (N-term)
APG01851G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AMBRA1 (N-term). This antibody is tested and proven to work in the following applications:
AMBRA1 Conjugated Antibody
C36091 100ul
EUR 397
anti- AMBRA1 antibody
FNab00356 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: autophagy/beclin-1 regulator 1
  • Uniprot ID: Q9C0C7
  • Gene ID: 55626
  • Research Area: Neuroscience, Cardiovascular, Developmental biology
Description: Antibody raised against AMBRA1
Anti-AMBRA1 antibody
PAab00356 100 ug
EUR 355
Anti-AMBRA1 antibody
STJ98593 200 µl
EUR 197
Description: Rabbit polyclonal to AMBRA1.
Anti-AMBRA1 antibody
STJ22601 100 µl
EUR 277
Anti-AMBRA1 antibody
STJ114452 100 µl
EUR 277
AMBRA1 siRNA
20-abx907360
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
AMBRA1 siRNA
20-abx907361
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Antibody for Human AMBRA1
SPC-644D 0.1mg
EUR 354
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is unconjugated.
Antibody for Human AMBRA1
SPC-644D-A390 0.1mg
EUR 401
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to ATTO 390.
Antibody for Human AMBRA1
SPC-644D-A488 0.1mg
EUR 400
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to ATTO 488.
Antibody for Human AMBRA1
SPC-644D-A565 0.1mg
EUR 400
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to ATTO 565.
Antibody for Human AMBRA1
SPC-644D-A594 0.1mg
EUR 400
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to ATTO 594.
Antibody for Human AMBRA1
SPC-644D-A633 0.1mg
EUR 400
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to ATTO 633.
Antibody for Human AMBRA1
SPC-644D-A655 0.1mg
EUR 400
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to ATTO 655.
Antibody for Human AMBRA1
SPC-644D-A680 0.1mg
EUR 400
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to ATTO 680.
Antibody for Human AMBRA1
SPC-644D-A700 0.1mg
EUR 400
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to ATTO 700.
Antibody for Human AMBRA1
SPC-644D-ALP 0.1mg
EUR 394
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to Alkaline Phosphatase.
Antibody for Human AMBRA1
SPC-644D-APC 0.1mg
EUR 399
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to APC .
Antibody for Human AMBRA1
SPC-644D-APCCY7 0.1mg
EUR 471
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to APC/Cy7.
Antibody for Human AMBRA1
SPC-644D-BI 0.1mg
EUR 396
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to Biotin.
Antibody for Human AMBRA1
SPC-644D-DY350 0.1mg
EUR 414
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to Dylight 350.
Antibody for Human AMBRA1
SPC-644D-DY405 0.1mg
EUR 403
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to Dylight 405.
Antibody for Human AMBRA1
SPC-644D-DY488 0.1mg
EUR 393
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to Dylight 488.
Antibody for Human AMBRA1
SPC-644D-DY594 0.1mg
EUR 395
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to Dylight 594.
Antibody for Human AMBRA1
SPC-644D-DY633 0.1mg
EUR 390
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to Dylight 633.
Antibody for Human AMBRA1
SPC-644D-FITC 0.1mg
EUR 392
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to FITC.
Antibody for Human AMBRA1
SPC-644D-HRP 0.1mg
EUR 388
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to HRP.
Antibody for Human AMBRA1
SPC-644D-P594 0.1mg
EUR 407
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to PE/ATTO 594.
Antibody for Human AMBRA1
SPC-644D-PCP 0.1mg
EUR 399
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to PerCP.
Antibody for Human AMBRA1
SPC-644D-RPE 0.1mg
EUR 397
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to RPE .
Antibody for Human AMBRA1
SPC-644D-STR 0.1mg
EUR 398
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to Streptavidin.
Antibody for Human AMBRA1
SPC-644S 0.012mg
EUR 65
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is unconjugated.
AMBRA1 cloning plasmid
CSB-CL883655HU-10ug 10ug
EUR 1319
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3627
  • Sequence: atgaaggttgtcccagaaaagaatgctgtccggatactctgggggcgagaacggggtgctcgggccatgggagctcagcggcttctgcaggagctggtagaggataaaacccggtggatgaaatgggagggcaagagagtagaactgccggatagtccacgctctaccttcttat
  • Show more
Description: A cloning plasmid for the AMBRA1 gene.
AMBRA1 Blocking Peptide
DF6228-BP 1mg
EUR 195
AMBRA1 ELISA KIT|Human
EF007742 96 Tests
EUR 689
Human AMBRA1 shRNA Plasmid
20-abx960784
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse AMBRA1 shRNA Plasmid
20-abx981622
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
AMBRA1 ORF Vector (Human) (pORF)
ORF000372 1.0 ug DNA
EUR 95
Ambra1 ORF Vector (Mouse) (pORF)
ORF038520 1.0 ug DNA
EUR 506
Ambra1 ORF Vector (Mouse) (pORF)
ORF038521 1.0 ug DNA
EUR 506
Ambra1 ORF Vector (Rat) (pORF)
ORF063347 1.0 ug DNA
EUR 506
AMBRA1 sgRNA CRISPR Lentivector set (Human)
K0079601 3 x 1.0 ug
EUR 339
Ambra1 sgRNA CRISPR Lentivector set (Mouse)
K5022401 3 x 1.0 ug
EUR 339
Ambra1 sgRNA CRISPR Lentivector set (Rat)
K6648101 3 x 1.0 ug
EUR 339
Rabbit Activating molecule in BECN1 regulated autophagy protein 1(AMBRA1) ELISA kit
E04A1416-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Activating molecule in BECN1 regulated autophagy protein 1(AMBRA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Activating molecule in BECN1 regulated autophagy protein 1(AMBRA1) ELISA kit
E04A1416-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Activating molecule in BECN1 regulated autophagy protein 1(AMBRA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Activating molecule in BECN1 regulated autophagy protein 1(AMBRA1) ELISA kit
E04A1416-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Activating molecule in BECN1 regulated autophagy protein 1(AMBRA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
AMBRA1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0079602 1.0 ug DNA
EUR 154
AMBRA1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0079603 1.0 ug DNA
EUR 154
AMBRA1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0079604 1.0 ug DNA
EUR 154
Ambra1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K5022402 1.0 ug DNA
EUR 154
Ambra1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K5022403 1.0 ug DNA
EUR 154
Ambra1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K5022404 1.0 ug DNA
EUR 154
Ambra1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6648102 1.0 ug DNA
EUR 154
Ambra1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6648103 1.0 ug DNA
EUR 154
Ambra1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6648104 1.0 ug DNA
EUR 154
AMBRA1 Protein Vector (Human) (pPB-C-His)
PV001485 500 ng
EUR 329
AMBRA1 Protein Vector (Human) (pPB-N-His)
PV001486 500 ng
EUR 329
AMBRA1 Protein Vector (Human) (pPM-C-HA)
PV001487 500 ng
EUR 329
AMBRA1 Protein Vector (Human) (pPM-C-His)
PV001488 500 ng
EUR 329
AMBRA1 Protein Vector (Mouse) (pPB-C-His)
PV154078 500 ng
EUR 1065
AMBRA1 Protein Vector (Mouse) (pPB-N-His)
PV154079 500 ng
EUR 1065
AMBRA1 Protein Vector (Mouse) (pPM-C-HA)
PV154080 500 ng
EUR 1065
AMBRA1 Protein Vector (Mouse) (pPM-C-His)
PV154081 500 ng
EUR 1065
AMBRA1 Protein Vector (Mouse) (pPB-C-His)
PV154082 500 ng
EUR 1065
AMBRA1 Protein Vector (Mouse) (pPB-N-His)
PV154083 500 ng
EUR 1065
AMBRA1 Protein Vector (Mouse) (pPM-C-HA)
PV154084 500 ng
EUR 1065
AMBRA1 Protein Vector (Mouse) (pPM-C-His)
PV154085 500 ng
EUR 1065
AMBRA1 Protein Vector (Human) (pPB-His-MBP)
PV321502 500 ng
EUR 329
AMBRA1 Protein Vector (Human) (pPB-His-GST)
PV321503 500 ng
EUR 329
AMBRA1 Protein Vector (Rat) (pPB-C-His)
PV253386 500 ng
EUR 1191
AMBRA1 Protein Vector (Rat) (pPB-N-His)
PV253387 500 ng
EUR 1191
AMBRA1 Protein Vector (Rat) (pPM-C-HA)
PV253388 500 ng
EUR 1191
AMBRA1 Protein Vector (Rat) (pPM-C-His)
PV253389 500 ng
EUR 1191
Ambra1 3'UTR Luciferase Stable Cell Line
TU200565 1.0 ml Ask for price
Ambra1 3'UTR GFP Stable Cell Line
TU151729 1.0 ml Ask for price
AMBRA1 3'UTR Luciferase Stable Cell Line
TU000687 1.0 ml
EUR 1521
Ambra1 3'UTR Luciferase Stable Cell Line
TU101729 1.0 ml Ask for price
AMBRA1 3'UTR GFP Stable Cell Line
TU050687 1.0 ml
EUR 1521
Ambra1 3'UTR GFP Stable Cell Line
TU250565 1.0 ml Ask for price
Activating Molecule In BECN1-Regulated Autophagy Protein 1 (AMBRA1) Antibody
20-abx111176
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Activating Molecule In BECN1-Regulated Autophagy Protein 1 (AMBRA1) Antibody
20-abx001006
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Activating Molecule In BECN1-Regulated Autophagy Protein 1 (AMBRA1) Antibody
abx030158-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Activating Molecule In BECN1-Regulated Autophagy Protein 1 (AMBRA1) Antibody
abx030158-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Activating Molecule In BECN1-Regulated Autophagy Protein 1 (AMBRA1) Antibody
20-abx321733
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Activating Molecule In BECN1-Regulated Autophagy Protein 1 (AMBRA1) Antibody
abx412109-01mg 0.1 mg
EUR 537
  • Shipped within 1 week.
Activating Molecule In BECN1-Regulated Autophagy Protein 1 (AMBRA1) Antibody
abx412111-01mg 0.1 mg
EUR 537
  • Shipped within 1 week.
Activating Molecule In BECN1-Regulated Autophagy Protein 1 (AMBRA1) Antibody
abx448517-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.
Activating molecule in BECN1-regulated autophagy protein 1 (AMBRA1) Antibody
20-abx212594
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Activating molecule in BECN1-regulated autophagy protein 1 (AMBRA1) Antibody
20-abx212836
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Activating Molecule In BECN1-Regulated Autophagy Protein 1 (AMBRA1) Antibody
20-abx225031
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Activating Molecule In BECN1-Regulated Autophagy Protein 1 (AMBRA1) Antibody
abx230356-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

AMBRA1 Rabbit Polyclonal Antibody