AMBRA1 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

Polyclonal Ambra1 Antibody
APG01849G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Ambra1 . This antibody is tested and proven to work in the following applications:

AMBRA1 Polyclonal Antibody
ABP57487-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthetic Peptide of AMBRA1 Applications tips:
Description: A polyclonal antibody for detection of AMBRA1 from Human, Mouse. This AMBRA1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of AMBRA1

AMBRA1 Polyclonal Antibody
ABP57487-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthetic Peptide of AMBRA1 Applications tips:
Description: A polyclonal antibody for detection of AMBRA1 from Human, Mouse. This AMBRA1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of AMBRA1

AMBRA1 Polyclonal Antibody
ABP57487-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthetic Peptide of AMBRA1 Applications tips:
Description: A polyclonal antibody for detection of AMBRA1 from Human, Mouse. This AMBRA1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of AMBRA1

AMBRA1 Polyclonal Antibody
ES8480-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against AMBRA1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

AMBRA1 Polyclonal Antibody
ES8480-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against AMBRA1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Rabbit Anti Ambra1 (C-Terminal) Polyclonal Antibody
CPBT-66429RA	Creative Diagnostics	50 µg	EUR 533

Rabbit Anti Ambra1 (C-Terminal) Polyclonal Antibody
CPBT-66430RA	Creative Diagnostics	0.1 mg	EUR 663

Rabbit Anti Ambra1 (N-Terminal) Polyclonal Antibody
CPBT-66432RA	Creative Diagnostics	0.1 mg	EUR 663

AMBRA1 Rabbit pAb
A12578-100ul	Abclonal	100 ul	EUR 308

AMBRA1 Rabbit pAb
A12578-200ul	Abclonal	200 ul	EUR 459

AMBRA1 Rabbit pAb
A12578-20ul	Abclonal	20 ul	EUR 183

AMBRA1 Rabbit pAb
A12578-50ul	Abclonal	50 ul	EUR 223

Ambra1 Antibody
24666-100ul	SAB	100ul	EUR 390

Ambra1 Antibody
24667-100ul	SAB	100ul	EUR 390

AMBRA1 antibody
70R-15693	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal AMBRA1 antibody

AMBRA1 Antibody
36091-100ul	SAB	100ul	EUR 252

AMBRA1 antibody
38182-100ul	SAB	100ul	EUR 252

AMBRA1 Antibody
1-CSB-PA001655GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against AMBRA1. Recognizes AMBRA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

AMBRA1 Antibody
1-CSB-PA927593	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AMBRA1. Recognizes AMBRA1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

AMBRA1 Antibody
1-CSB-PA883655ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against AMBRA1. Recognizes AMBRA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

AMBRA1 Antibody
DF6228	Affbiotech	200ul	EUR 304
Description: AMBRA1 Antibody detects endogenous levels of total AMBRA1.

AMBRA1 Antibody
1-CSB-PA163788	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AMBRA1. Recognizes AMBRA1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

AMBRA1 Antibody
ABD6228	Lifescience Market	100 ug	EUR 438

Polyclonal AMBRA1 Antibody (aa1-50)
APG01850G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AMBRA1 (aa1-50). This antibody is tested and proven to work in the following applications:

Polyclonal AMBRA1 Antibody (N-term)
APG01851G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AMBRA1 (N-term). This antibody is tested and proven to work in the following applications:

AMBRA1 Conjugated Antibody
C36091	SAB	100ul	EUR 397

anti- AMBRA1 antibody
FNab00356	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: autophagy/beclin-1 regulator 1 Uniprot ID: Q9C0C7 Gene ID: 55626 Research Area: Neuroscience, Cardiovascular, Developmental biology
Description: Antibody raised against AMBRA1

Anti-AMBRA1 antibody
PAab00356	Lifescience Market	100 ug	EUR 355

Anti-AMBRA1 antibody
STJ114452	St John's Laboratory	100 µl	EUR 277

Anti-AMBRA1 antibody
STJ22601	St John's Laboratory	100 µl	EUR 277

Anti-AMBRA1 antibody
STJ98593	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to AMBRA1.

AMBRA1 siRNA
20-abx907360	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

AMBRA1 siRNA
20-abx907361	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Antibody for Human AMBRA1
SPC-644D	Stressmarq	0.1mg	EUR 354
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is unconjugated.

Antibody for Human AMBRA1
SPC-644D-A390	Stressmarq	0.1mg	EUR 401
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to ATTO 390.

Antibody for Human AMBRA1
SPC-644D-A488	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to ATTO 488.

Antibody for Human AMBRA1
SPC-644D-A565	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to ATTO 565.

Antibody for Human AMBRA1
SPC-644D-A594	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to ATTO 594.

Antibody for Human AMBRA1
SPC-644D-A633	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to ATTO 633.

Antibody for Human AMBRA1
SPC-644D-A655	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to ATTO 655.

Antibody for Human AMBRA1
SPC-644D-A680	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to ATTO 680.

Antibody for Human AMBRA1
SPC-644D-A700	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to ATTO 700.

Antibody for Human AMBRA1
SPC-644D-ALP	Stressmarq	0.1mg	EUR 394
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human AMBRA1
SPC-644D-APC	Stressmarq	0.1mg	EUR 399
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to APC .

Antibody for Human AMBRA1
SPC-644D-APCCY7	Stressmarq	0.1mg	EUR 471
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to APC/Cy7.

Antibody for Human AMBRA1
SPC-644D-BI	Stressmarq	0.1mg	EUR 396
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to Biotin.

Antibody for Human AMBRA1
SPC-644D-DY350	Stressmarq	0.1mg	EUR 414
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to Dylight 350.

Antibody for Human AMBRA1
SPC-644D-DY405	Stressmarq	0.1mg	EUR 403
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to Dylight 405.

Antibody for Human AMBRA1
SPC-644D-DY488	Stressmarq	0.1mg	EUR 393
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to Dylight 488.

Antibody for Human AMBRA1
SPC-644D-DY594	Stressmarq	0.1mg	EUR 395
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to Dylight 594.

Antibody for Human AMBRA1
SPC-644D-DY633	Stressmarq	0.1mg	EUR 390
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to Dylight 633.

Antibody for Human AMBRA1
SPC-644D-FITC	Stressmarq	0.1mg	EUR 392
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to FITC.

Antibody for Human AMBRA1
SPC-644D-HRP	Stressmarq	0.1mg	EUR 388
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to HRP.

Antibody for Human AMBRA1
SPC-644D-P594	Stressmarq	0.1mg	EUR 407
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to PE/ATTO 594.

Antibody for Human AMBRA1
SPC-644D-PCP	Stressmarq	0.1mg	EUR 399
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to PerCP.

Antibody for Human AMBRA1
SPC-644D-RPE	Stressmarq	0.1mg	EUR 397
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to RPE .

Antibody for Human AMBRA1
SPC-644D-STR	Stressmarq	0.1mg	EUR 398
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is conjugated to Streptavidin.

Antibody for Human AMBRA1
SPC-644S	Stressmarq	0.012mg	EUR 65
Description: A polyclonal antibody for AMBRA1 from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide of Human AMBRA1 (aa. 200-300). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This AMBRA1 antibody is unconjugated.

AMBRA1 Blocking Peptide
DF6228-BP	Affbiotech	1mg	EUR 195

AMBRA1 cloning plasmid
CSB-CL883655HU-10ug	Cusabio	10ug	EUR 1319
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3627 Sequence: atgaaggttgtcccagaaaagaatgctgtccggatactctgggggcgagaacggggtgctcgggccatgggagctcagcggcttctgcaggagctggtagaggataaaacccggtggatgaaatgggagggcaagagagtagaactgccggatagtccacgctctaccttcttat Show more
Description: A cloning plasmid for the AMBRA1 gene.

AMBRA1 ELISA KIT|Human
EF007742	Lifescience Market	96 Tests	EUR 689

Human AMBRA1 shRNA Plasmid
20-abx960784	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse AMBRA1 shRNA Plasmid
20-abx981622	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Ambra1 ORF Vector (Rat) (pORF)
ORF063347	ABM	1.0 ug DNA	EUR 506

AMBRA1 ORF Vector (Human) (pORF)
ORF000372	ABM	1.0 ug DNA	EUR 95

Ambra1 ORF Vector (Mouse) (pORF)
ORF038520	ABM	1.0 ug DNA	EUR 506

Ambra1 ORF Vector (Mouse) (pORF)
ORF038521	ABM	1.0 ug DNA	EUR 506

Ambra1 sgRNA CRISPR Lentivector set (Mouse)
K5022401	ABM	3 x 1.0 ug	EUR 339

Ambra1 sgRNA CRISPR Lentivector set (Rat)
K6648101	ABM	3 x 1.0 ug	EUR 339

AMBRA1 sgRNA CRISPR Lentivector set (Human)
K0079601	ABM	3 x 1.0 ug	EUR 339

Rabbit Activating molecule in BECN1 regulated autophagy protein 1(AMBRA1) ELISA kit
E04A1416-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Activating molecule in BECN1 regulated autophagy protein 1(AMBRA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Activating molecule in BECN1 regulated autophagy protein 1(AMBRA1) ELISA kit
E04A1416-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Activating molecule in BECN1 regulated autophagy protein 1(AMBRA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Activating molecule in BECN1 regulated autophagy protein 1(AMBRA1) ELISA kit
E04A1416-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Activating molecule in BECN1 regulated autophagy protein 1(AMBRA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Ambra1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K5022402	ABM	1.0 ug DNA	EUR 154

Ambra1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K5022403	ABM	1.0 ug DNA	EUR 154

Ambra1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K5022404	ABM	1.0 ug DNA	EUR 154

Ambra1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6648102	ABM	1.0 ug DNA	EUR 154

Ambra1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6648103	ABM	1.0 ug DNA	EUR 154

Ambra1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6648104	ABM	1.0 ug DNA	EUR 154

AMBRA1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0079602	ABM	1.0 ug DNA	EUR 154

AMBRA1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0079603	ABM	1.0 ug DNA	EUR 154

AMBRA1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0079604	ABM	1.0 ug DNA	EUR 154

AMBRA1 Protein Vector (Mouse) (pPB-C-His)
PV154078	ABM	500 ng	EUR 1065

AMBRA1 Protein Vector (Mouse) (pPB-N-His)
PV154079	ABM	500 ng	EUR 1065

AMBRA1 Protein Vector (Mouse) (pPM-C-HA)
PV154080	ABM	500 ng	EUR 1065

AMBRA1 Protein Vector (Mouse) (pPM-C-His)
PV154081	ABM	500 ng	EUR 1065

AMBRA1 Protein Vector (Mouse) (pPB-C-His)
PV154082	ABM	500 ng	EUR 1065

AMBRA1 Protein Vector (Mouse) (pPB-N-His)
PV154083	ABM	500 ng	EUR 1065

AMBRA1 Protein Vector (Mouse) (pPM-C-HA)
PV154084	ABM	500 ng	EUR 1065

AMBRA1 Protein Vector (Mouse) (pPM-C-His)
PV154085	ABM	500 ng	EUR 1065

AMBRA1 Protein Vector (Rat) (pPB-C-His)
PV253386	ABM	500 ng	EUR 1191

AMBRA1 Protein Vector (Rat) (pPB-N-His)
PV253387	ABM	500 ng	EUR 1191

AMBRA1 Protein Vector (Rat) (pPM-C-HA)
PV253388	ABM	500 ng	EUR 1191

AMBRA1 Protein Vector (Rat) (pPM-C-His)
PV253389	ABM	500 ng	EUR 1191

AMBRA1 Protein Vector (Human) (pPB-His-MBP)
PV321502	ABM	500 ng	EUR 329

AMBRA1 Protein Vector (Human) (pPB-His-GST)
PV321503	ABM	500 ng	EUR 329

AMBRA1 Protein Vector (Human) (pPB-C-His)
PV001485	ABM	500 ng	EUR 329

AMBRA1 Protein Vector (Human) (pPB-N-His)
PV001486	ABM	500 ng	EUR 329

AMBRA1 Rabbit Polyclonal Antibody