ERLIN1/2 Rabbit Polyclonal Antibody

ERLIN1/2 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

ERLIN1/2 Polyclonal Antibody
ES8507-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERLIN1/2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
ERLIN1/2 Polyclonal Antibody
ABP57514-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from ERLIN1/2 at AA range: 31-80
  • Applications tips:
Description: A polyclonal antibody for detection of ERLIN1/2 from Human, Mouse, Rat. This ERLIN1/2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from ERLIN1/2 at AA range: 31-80
ERLIN1/2 Polyclonal Antibody
ABP57514-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from ERLIN1/2 at AA range: 31-80
  • Applications tips:
Description: A polyclonal antibody for detection of ERLIN1/2 from Human, Mouse, Rat. This ERLIN1/2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from ERLIN1/2 at AA range: 31-80
ERLIN1/2 Polyclonal Antibody
ABP57514-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from ERLIN1/2 at AA range: 31-80
  • Applications tips:
Description: A polyclonal antibody for detection of ERLIN1/2 from Human, Mouse, Rat. This ERLIN1/2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from ERLIN1/2 at AA range: 31-80
ERLIN1/2 Polyclonal Antibody
46738-100ul 100ul
EUR 252
ERLIN1/2 Polyclonal Antibody
46738-50ul 50ul
EUR 187
ERLIN1/2 Polyclonal Conjugated Antibody
C46738 100ul
EUR 397
ERLIN1 Polyclonal Antibody
A58954 100 µg
EUR 570.55
Description: reagents widely cited
ERLIN1 Polyclonal Antibody
28725-100ul 100ul
EUR 252
ERLIN1 Polyclonal Antibody
28725-50ul 50ul
EUR 187
ERLIN1 Rabbit pAb
A4440-100ul 100 ul
EUR 308
ERLIN1 Rabbit pAb
A4440-200ul 200 ul
EUR 459
ERLIN1 Rabbit pAb
A4440-20ul 20 ul Ask for price
ERLIN1 Rabbit pAb
A4440-50ul 50 ul Ask for price
ERLIN1 Rabbit pAb
A14843-100ul 100 ul
EUR 308
ERLIN1 Rabbit pAb
A14843-200ul 200 ul
EUR 459
ERLIN1 Rabbit pAb
A14843-20ul 20 ul
EUR 183
ERLIN1 Rabbit pAb
A14843-50ul 50 ul
EUR 223
ERLIN1 Polyclonal Conjugated Antibody
C32000 100ul
EUR 397
ERLIN1 Polyclonal Conjugated Antibody
C28725 100ul
EUR 397
Anti-ERLIN1/2 Antibody
A08034-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ERLIN1/2 Antibody (ERLIN1) detection.tested for IHC, WB in Human, Mouse, Rat.
Anti-ERLIN1/2 antibody
STJ98620 200 µl
EUR 197
Description: Rabbit polyclonal to ERLIN1/2.
Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit
EUR 554
  • Should the Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ER Lipid Raft Associated Protein 1 (ERLIN1) in samples from tissue homogenates or other biological fluids.
Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit
EUR 725
  • Should the Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ER Lipid Raft Associated Protein 1 (ERLIN1) in samples from tissue homogenates or other biological fluids.
Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit
RD-ERLIN1-Hu-48Tests 48 Tests
EUR 563
Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit
RD-ERLIN1-Hu-96Tests 96 Tests
EUR 783
Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit
RDR-ERLIN1-Hu-48Tests 48 Tests
EUR 589
Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit
RDR-ERLIN1-Hu-96Tests 96 Tests
EUR 820
ERLIN1 antibody
70R-7393 50 ug
EUR 467
Description: Rabbit polyclonal ERLIN1 antibody raised against the N terminal of ERLIN1
ERLIN1 antibody
32000-100ul 100ul
EUR 252
ERLIN1 antibody
32000-50ul 50ul
EUR 187
ERLIN1 antibody
70R-17143 50 ul
EUR 435
Description: Rabbit polyclonal ERLIN1 antibody
ERLIN1 Antibody
DF12983 200ul
EUR 304
Description: ERLIN1 Antibody detects endogenous levels of ERLIN1.
ERLIN1 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ERLIN1. Recognizes ERLIN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
ERLIN1 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERLIN1. Recognizes ERLIN1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200
ERLIN1 Polyclonal Antibody, Biotin Conjugated
A58955 100 µg
EUR 570.55
Description: Ask the seller for details
ERLIN1 Polyclonal Antibody, FITC Conjugated
A58956 100 µg
EUR 570.55
Description: The best epigenetics products
ERLIN1 Polyclonal Antibody, HRP Conjugated
A58957 100 µg
EUR 570.55
Description: kits suitable for this type of research
anti- ERLIN1 antibody
FNab02848 100µg
EUR 505.25
  • Immunogen: ER lipid raft associated 1
  • Uniprot ID: O75477
  • Gene ID: 10613
  • Research Area: Metabolism
Description: Antibody raised against ERLIN1
Anti-ERLIN1 antibody
PAab02848 100 ug
EUR 355
Anti-ERLIN1 antibody
STJ26674 100 µl
EUR 277
Description: The protein encoded by this gene is part of a protein complex that mediates degradation of inositol 1,4,5-trisphosphate receptors in the endoplasmic reticulum. The encoded protein also binds cholesterol and regulates the SREBP signaling pathway, which promotes cellular cholesterol homeostasis. Defects in this gene have been associated with spastic paraplegia 62.
Anti-ERLIN1 antibody
STJ117043 100 µl
EUR 277
Description: The protein encoded by this gene is part of a protein complex that mediates degradation of inositol 1,4,5-trisphosphate receptors in the endoplasmic reticulum. The encoded protein also binds cholesterol and regulates the SREBP signaling pathway, which promotes cellular cholesterol homeostasis. Defects in this gene have been associated with spastic paraplegia 62.
Rabbit Polyclonal Antibody to Human Topoisomerase I (Rabbit Serum)
TG2012-2 250 ul
EUR 380
Anti-Bcl-2 Rabbit Monoclonal Antibody
M00040-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Bcl-2 Antibody. Validated in IF, WB and tested in Human, Mouse.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ERLIN1 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERLIN1. Recognizes ERLIN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ERLIN1 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERLIN1. Recognizes ERLIN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ERLIN1 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERLIN1. Recognizes ERLIN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Anti-KEO4 / ERLIN1 antibody
STJ71953 100 µg
EUR 359
Anti-COX-2 Rabbit Monoclonal Antibody, Clone#RM348
M00084-2 100uL
EUR 397
Description: Anti-COX-2 Rabbit Monoclonal Antibody, Clone#RM348 tested in WB, IHC, reactive to Human
ERLIN1 cloning plasmid
CSB-CL007790HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1041
  • Sequence: atgactcaagcccgggttctggtggctgcagtggtggggttggtggctgtcctgctctacgcctccatccacaagattgaggagggccatctggctgtgtactacaggggaggagctttactaactagccccagtggaccaggctatcatatcatgttgcctttcattactacgt
  • Show more
Description: A cloning plasmid for the ERLIN1 gene.
ERLIN1 Blocking Peptide
33R-4577 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ERLIN1 antibody, catalog no. 70R-7393
ERLIN1 Blocking Peptide
DF12983-BP 1mg
EUR 195
Erlin1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4469603 1.0 ug DNA
EUR 154
Erlin1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6113603 1.0 ug DNA
EUR 154
ERLIN1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0693103 1.0 ug DNA
EUR 154
Mouse ERLIN1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human ERLIN1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ERLIN1 Recombinant Protein (Human)
RP010903 100 ug Ask for price
ERLIN1 Recombinant Protein (Rat)
RP199907 100 ug Ask for price
ERLIN1 Recombinant Protein (Mouse)
RP132185 100 ug Ask for price
ERLIN1 Recombinant Protein (Mouse)
RP132188 100 ug Ask for price
ERLIN1 Recombinant Protein (Mouse)
RP132191 100 ug Ask for price
Anti-p53 Rabbit Monoclonal Antibody
M00001-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal p53 Antibody. Validated in ICC/IF, WB and tested in Human.
Anti-PTEN Rabbit Monoclonal Antibody
M00006-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal PTEN Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.
Anti-STAT3 Rabbit Monoclonal Antibody
M00007-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal STAT3 Antibody. Validated in IP, IF, WB and tested in Human.
Anti-Rb Rabbit Monoclonal Antibody
M00039-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Rb Antibody. Validated in IP, IF, WB and tested in Human, Mouse.
Anti-Ras Rabbit Monoclonal Antibody
M00099-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Ras Antibody. Validated in Flow Cytometry, IP, WB and tested in Human, Mouse, Rat.
Anti-ERK1 Rabbit Monoclonal Antibody
M00104-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal ERK1 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.
Anti-p21 Rabbit Monoclonal Antibody
M00145-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal p21 Antibody. Validated in IF, ICC, WB and tested in Human, Mouse, Rat.
Anti-p38 Rabbit Monoclonal Antibody
M00176-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal p38 Antibody. Validated in ChIP, IP, IF, WB and tested in Human, Mouse, Rat.
Anti-Rho Rabbit Monoclonal Antibody
M00207-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Rho Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.
Anti-GFAP Rabbit Monoclonal Antibody
M00213-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal GFAP Antibody. Validated in IF, IHC, WB and tested in Human, Rat.
Anti-LRRK2 Rabbit Monoclonal Antibody
M00221-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal LRRK2 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat.
Anti-MiTF Rabbit Monoclonal Antibody
M00269-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal MiTF Antibody. Validated in WB and tested in Human, Mouse, Rat.
Anti-PAX6 Rabbit Monoclonal Antibody
M00273-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal PAX6 Antibody. Validated in WB and tested in Human, Mouse, Rat.
Anti-MEK1 Rabbit Monoclonal Antibody
M00292-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal MEK1 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.
Anti-Survivin Rabbit Monoclonal Antibody
M00379-2 100ug/vial
EUR 397
Description: Anti-Survivin Rabbit Monoclonal Antibody tested for IP, IHC, WB in Mouse, Rat
Anti-Hsp27 Rabbit Monoclonal Antibody
M00676-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Hsp27 Antibody. Validated in Flow Cytometry and tested in Human, Mouse, Rat.
Anti-SOX10 Rabbit Monoclonal Antibody
M00758-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal SOX10 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.
Anti-PAX8 Rabbit Monoclonal Antibody
M00943-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal PAX8 Antibody. Validated in IF, WB and tested in Human.
Anti-PGP9.5 Rabbit Monoclonal Antibody
M01018-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal PGP9.5 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.
Anti-Podoplanin Rabbit Monoclonal Antibody
M01124-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Podoplanin Antibody. Validated in WB and tested in Human.
Anti-CD74 Rabbit Monoclonal Antibody
M01340-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD74 Antibody. Validated in IF, WB and tested in Human.
Anti-CD31 Rabbit Monoclonal Antibody
M01513-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD31 Antibody. Validated in WB and tested in Human.
Anti-Actin Rabbit Monoclonal Antibody
M02014-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Actin Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.
Anti-MBP Rabbit Monoclonal Antibody
M30934-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal MBP Antibody. Validated in WB and tested in All species.
Anti-GFP Rabbit Monoclonal Antibody
M30939-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal GFP Antibody. Validated in IF, IHC, ICC, WB and tested in Human, Mouse, Rat.
Cyclooxygenase 2 Rabbit Polyclonal Antibody
38024-100ul 100ul
EUR 252
Cyclooxygenase 2 Rabbit Polyclonal Antibody
38024-50ul 50ul
EUR 187
IGFBP-2 Polyclonal Antibody (Rabbit)
PAAI1 200 µg
EUR 299
Anti-Caspase-8 Rabbit Monoclonal Antibody
M00042-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Caspase-8 Antibody. Validated in ICC/IF, WB and tested in Human.
Anti-ER alpha Rabbit Monoclonal Antibody
M00057-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal ER alpha Antibody. Validated in ChIP, Flow Cytometry, IF, IHC, ICC, WB and tested in Canine, Human, Mouse, Rat.
Anti-Cleaved PARP Rabbit Monoclonal Antibody
M00122-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cleaved PARP Antibody. Validated in Flow Cytometry, IP, IF, ICC, WB and tested in Human.
Anti-CDK1/Cdc2 Rabbit Monoclonal Antibody
M00209-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal CDK1/Cdc2 Antibody. Validated in IP, IF, IHC, WB and tested in Human.
Anti-Androgen Receptor Rabbit Monoclonal Antibody
M00542-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Androgen Receptor Antibody. Validated in IF, IHC, ICC, WB and tested in Human, Mouse, Rat.
Anti-Cyclin B1 Rabbit Monoclonal Antibody
M00745-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cyclin B1 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse.
Anti-Liver Arginase Rabbit Monoclonal Antibody
M01106-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Liver Arginase Antibody. Validated in IP, IF, IHC, WB and tested in Human.
Anti-Sumo2/3 Rabbit Monoclonal Antibody
M01282-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Sumo2/3 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.
Anti-Cytokeratin 18 Rabbit Monoclonal Antibody
M01357-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cytokeratin 18 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.
Anti-Cytokeratin 8 Rabbit Monoclonal Antibody
M01421-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cytokeratin 8 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse.
Anti-Cytokeratin 14 Rabbit Monoclonal Antibody
M01432-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cytokeratin 14 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.
Anti-CD8 alpha Rabbit Monoclonal Antibody
M02236-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD8 alpha Antibody. Validated in IHC and tested in Human.
Anti-Cytokeratin 7 Rabbit Monoclonal Antibody
M02416-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cytokeratin 7 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.
Anti-Caspase-6 Rabbit Monoclonal Antibody
M02631-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Caspase-6 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.
Anti-CD3 epsilon Rabbit Monoclonal Antibody
M02675-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD3 epsilon Antibody. Validated in Flow Cytometry, IP, IHC, WB and tested in Human.
Anti-Histone H4 Rabbit Monoclonal Antibody
M14495-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Histone H4 Antibody. Validated in ChIP, IP, IF, WB and tested in Human, Mouse, Rat.
Anti-Histone H2A Rabbit Monoclonal Antibody
M16777-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Histone H2A Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.
Anti-EpCAM/Trop1 Rabbit Monoclonal Antibody
M30950-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal EpCAM/Trop1 Antibody. Validated in WB and tested in Human.
Anti-Cytochrome C Rabbit Monoclonal Antibody
M03529-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cytochrome C Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.
Anti-HER2 Rabbit Monoclonal Antibody, Clone#RM228
M00010-2 100ul
EUR 375
Description: Anti-HER2 Rabbit Monoclonal Antibody, Clone#RM228 tested in WB, IHC, reactive to Human
Anti-CD44 Rabbit Monoclonal Antibody, Clone#RM264
M00052-2 100uL
EUR 375
Description: Anti-CD44 Rabbit Monoclonal Antibody, Clone#RM264 tested in WB, IHC, reactive to Human
Anti-BRAF Rabbit Monoclonal Antibody, Clone#RM308
M00075-2 100uL
EUR 385
Description: Anti-BRAF Rabbit Monoclonal Antibody, Clone#RM308 tested in WB, IHC, reactive to Human
Anti-cleaved Caspase-9 Rabbit Monoclonal Antibody
M00080-2 100ug/vial
EUR 397
Description: Anti-cleaved Caspase-9 Rabbit Monoclonal Antibody tested for IP, WB in Human, Mouse
Anti-CD19 Rabbit Monoclonal Antibody, Clone#RM332
M00154-2 100uL
EUR 385
Description: Anti-CD19 Rabbit Monoclonal Antibody, Clone#RM332 tested in WB, IHC, reactive to Human
Anti-CD56 Rabbit Monoclonal Antibody, Clone#RM315
M00184-2 100uL
EUR 385
Description: Anti-CD56 Rabbit Monoclonal Antibody, Clone#RM315 tested in WB, IHC, reactive to Human
Anti-MHC class I Rabbit Monoclonal Antibody
M00194-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal MHC class I Antibody. Validated in IF, WB and tested in Human.
Anti-Caspase-3 p12 Rabbit Monoclonal Antibody
M00334-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Caspase-3 p12 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.
Anti-CD45 Rabbit Monoclonal Antibody, Clone#RM291
M00555-2 100uL
EUR 397
Description: Anti-CD45 Rabbit Monoclonal Antibody, Clone#RM291 tested in WB, IHC, reactive to Human
Anti-Integrin beta 1 Rabbit Monoclonal Antibody
M00772-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Integrin beta 1 Antibody. Validated in IHC, WB and tested in Human.
Anti-MyoD1 Rabbit Monoclonal Antibody, Clone#RM369
M00964-2 100uL
EUR 385
Description: Anti-MyoD1 Rabbit Monoclonal Antibody, Clone#RM369 tested in WB, IHC, reactive to Human
Anti-Hsp90 alpha + beta Rabbit Monoclonal Antibody
M01103-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Hsp90 alpha + beta Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat.
Anti-CD146 Rabbit Monoclonal Antibody, Clone#RM249
M01683-2 100ul
EUR 375
Description: Anti-CD146 Rabbit Monoclonal Antibody, Clone#RM249 tested in WB, IHC, reactive to Human, (Mouse, Rat)
Anti-MART1 Rabbit Monoclonal Antibody, Clone#RM333
M02033-2 100uL
EUR 385
Description: Anti-MART1 Rabbit Monoclonal Antibody, Clone#RM333 tested in WB, IHC, reactive to Human
Anti-14-3-3 Rabbit Monoclonal Antibody
M02431-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal 14-3-3 Antibody. Validated in WB and tested in Human, Mouse, Rat.
Anti-CD5 Rabbit Monoclonal Antibody, Clone#RM354
M02591-2 100uL
EUR 385
Description: Anti-CD5 Rabbit Monoclonal Antibody, Clone#RM354 tested in WB, IHC, reactive to Human
Anti-CD20 Rabbit Monoclonal Antibody, Clone#RM272
M03780-2 100uL
EUR 455
Description: Anti-CD20 Rabbit Monoclonal Antibody, Clone#RM272 tested in WB, IHC, reactive to Human
Anti-CD10 Rabbit Monoclonal Antibody, Clone#RM337
M04065-2 100uL
EUR 397
Description: Anti-CD10 Rabbit Monoclonal Antibody, Clone#RM337 tested in WB, IHC, reactive to Human
Anti-Synaptophysin Rabbit Monoclonal Antibody, Clone#RM258
M05049-2 100uL
EUR 385
Description: Anti-Synaptophysin Rabbit Monoclonal Antibody, Clone#RM258 tested in WB, IHC, reactive to Human
Anti-NEFH/Nf H Rabbit Monoclonal Antibody
M05307-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal NEFH/Nf H Antibody. Validated in WB and tested in Human, Mouse, Rat.
Anti-p53 (acetyl K382) Rabbit Monoclonal Antibody
P00001-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal p53 (acetyl K382) Antibody. Validated in IF, IHC, ICC, WB and tested in Human.
Anti-Phospho-STAT3 (Y705) Rabbit Monoclonal Antibody
P00007-2 100ug/vial
EUR 397
Description: Anti-Phospho-STAT3 (Y705) Rabbit Monoclonal Antibody tested for IP, IF, IHC, ICC, WB in Human, Mouse, Rat
Anti-Phospho-EGFR (Y1173) Rabbit Monoclonal Antibody
P00023-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-EGFR (Y1173) Antibody. Validated in IP, IF, WB and tested in Human.
Anti-Phospho-AKT1 (T450) Rabbit Monoclonal Antibody
P00024-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-AKT1 (T450) Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.
Anti-Phospho-Tau (S396) Rabbit Monoclonal Antibody
P00097-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-Tau (S396) Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.
Anti-Phospho-PLK1 (T210) Rabbit Monoclonal Antibody
P00182-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-PLK1 (T210) Antibody. Validated in WB and tested in Human.
Anti-Phospho-POLR2A (S5) Rabbit Monoclonal Antibody
P01029-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-POLR2A (S5) Antibody. Validated in Flow Cytometry, IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.
ERLIN1 ORF Vector (Human) (pORF)
ORF003635 1.0 ug DNA
EUR 95
Erlin1 ORF Vector (Rat) (pORF)
ORF066637 1.0 ug DNA
EUR 506
Erlin1 ORF Vector (Mouse) (pORF)
ORF044063 1.0 ug DNA
EUR 506
Erlin1 ORF Vector (Mouse) (pORF)
ORF044064 1.0 ug DNA
EUR 506
Erlin1 ORF Vector (Mouse) (pORF)
ORF044065 1.0 ug DNA
EUR 506
ERLIN1 ELISA Kit (Human) (OKCD02050)
OKCD02050 96 Wells
EUR 909
Description: Description of target: Component of the ERLIN1/ERLIN2 complex which mediates the endoplasmic reticulum-associated degradation (ERAD) of inositol 1,4,5-trisphosphate receptors (IP3Rs). Involved in regulation of cellular cholesterol homeostasis by regulation the SREBP signaling pathway. Binds cholesterol and may promote ER retention of the SCAP-SREBF complex.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.107 ng/mL
Anti-ErbB 2/ERBB2 Antibody
A00010-2 100ug/vial
EUR 334
Anti-Bcl-2/BCL2 Antibody
A00040-2 100ug/vial
EUR 334
Anti-Angiopoietin-2/ANGPT2 Antibody
A00370-2 100ug/vial
EUR 334
Anti-EIF4A1/2/3 Antibody
A03922-2 100ug/vial
EUR 334
Anti-Fascin 2/FSCN2 Antibody
A07840-2 100ug/vial
EUR 294
Anti-Histone H3 (acetyl K14) Rabbit Monoclonal Antibody
P12477-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Histone H3 (acetyl K14) Antibody. Validated in IP, IF, WB and tested in Human, Rat.
Anti-Caveolin-1 Rabbit Monoclonal Antibody, Clone#RM325
M00179-2 100uL
EUR 385
Description: Anti-Caveolin-1 Rabbit Monoclonal Antibody, Clone#RM325 tested in WB, IHC, reactive to Human
Anti-Histone H2AX Rabbit Monoclonal Antibody, Clone#RM214
M00241-2 100ug
EUR 478
Description: Anti-Histone H2AX Rabbit Monoclonal Antibody, Clone#RM214 tested in WB, ELISA, Multiplex, ICC, reactive to All Vertebrates
Anti-Cytokeratin 5 (C-term) Rabbit Monoclonal Antibody
M00398-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cytokeratin 5 (C-term) Antibody. Validated in IF, IHC, WB and tested in Human, Mouse.
Anti-S100-beta Rabbit Monoclonal Antibody, Clone#RM304
M00979-2 100uL
EUR 385
Description: Anti-S100-beta Rabbit Monoclonal Antibody, Clone#RM304 tested in WB, IHC, reactive to Human
Anti-alpha smooth muscle Actin Rabbit Monoclonal Antibody
M01072-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal alpha smooth muscle Actin Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.
Anti-HLA-DRA/Hla Dr Rabbit Monoclonal Antibody
M01195-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal HLA-DRA/Hla Dr Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.
Anti-TGFBI/Beta Ig H3 Rabbit Monoclonal Antibody
M01218-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal TGFBI/Beta Ig H3 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.
Anti- beta -Actin Rabbit Monoclonal Antibody, Clone#RM112
M01263-2 100uL
EUR 397
Description: Anti- beta -Actin Rabbit Monoclonal Antibody, Clone#RM112 tested in WB, IP, ICC, IHC, FC, ELISA , reactive to All Species
Anti-Desmin (DESM) Rabbit Monoclonal Antibody, Clone#RM234
M01948-2 100ul
EUR 375
Description: Anti-Desmin (DESM) Rabbit Monoclonal Antibody, Clone#RM234 tested in WB, IHC, reactive to Human, Mouse, (Bovine, Rat)
Anti-K63-linkage Specific Ubiquitin Rabbit Monoclonal Antibody
M02848-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal K63-linkage Specific Ubiquitin Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.
Anti-Mouse IgG2a Rabbit Monoclonal Antibody, Clone#RM219
M30946-2 100ug
EUR 398
Description: Anti-Mouse IgG2a Rabbit Monoclonal Antibody, Clone#RM219 tested in WB (nonreduced only), IP, ICC, IHC, FC, ELISA , reactive to Mouse
Anti-Smac/Diablo Rabbit Monoclonal Antibody, Clone#RM271
M03790-2 100uL
EUR 397
Description: Anti-Smac/Diablo Rabbit Monoclonal Antibody, Clone#RM271 tested in WB, IHC, reactive to Human
Anti-Mouse IgG1 Rabbit Monoclonal Antibody, Clone#RM106
M04575-2 100ug
EUR 375
Description: Anti-Mouse IgG1 Rabbit Monoclonal Antibody, Clone#RM106 tested in WB, IP, ICC, IHC, FC, ELISA , reactive to Mouse
Anti-Histone H2AZ Rabbit Monoclonal Antibody, Clone#RM215
M04816-2 100ug
EUR 468
Description: Anti-Histone H2AZ Rabbit Monoclonal Antibody, Clone#RM215 tested in WB, ELISA, Multiplex, ICC, reactive to All Vertebrates
Anti-Mouse IgM Rabbit Monoclonal Antibody, Clone#RM109
M07469-2 100ug
EUR 375
Description: Anti-Mouse IgM Rabbit Monoclonal Antibody, Clone#RM109 tested in ICC, IHC, IP, FC, ELISA, reactive to Mouse
Anti-Human IgA1 Rabbit Monoclonal Antibody, Clone#RM124
M07514-2 100ug
EUR 375
Description: Anti-Human IgA1 Rabbit Monoclonal Antibody, Clone#RM124 tested in ICC, IHC, FC, ELISA, reactive to Human
Anti-Calponin-1 Rabbit Monoclonal Antibody, Clone#RM262
M08065-2 100uL
EUR 375
Description: Anti-Calponin-1 Rabbit Monoclonal Antibody, Clone#RM262 tested in WB, ICC, reactive to Human, Mouse
Anti- alpha -Tubulin Rabbit Monoclonal Antibody, Clone#RM113
M08382-2 100uL
EUR 397
Description: Anti- alpha -Tubulin Rabbit Monoclonal Antibody, Clone#RM113 tested in WB, IP, ICC, IHC, FC, ELISA , reactive to All Species
Anti-Human IgG4 Rabbit Monoclonal Antibody, Clone#RM120
M11385-2 100ug
EUR 415
Description: Anti-Human IgG4 Rabbit Monoclonal Antibody, Clone#RM120 tested in WB, ICC, IHC, FC, ELISA , reactive to Human
Anti-Phospho-c-Myc (S62) Rabbit Monoclonal Antibody
P00026-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-c-Myc (S62) Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat.
Anti-Phospho-alpha Synuclein (S129) Rabbit Monoclonal Antibody
P00215-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-alpha Synuclein (S129) Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.
Anti-Phospho-AMPK alpha (T172) Rabbit Monoclonal Antibody
P01420-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-AMPK alpha (T172) Antibody. Validated in WB and tested in Human, Mouse, Rat.
Rabbit Complement Unadsorbed
31060-2 5mL
EUR 78
  • All products from Pel-Freez are available in Europe and worldwide via Gentaur. If you cannot find the item you need send us an inquiry and we will be in touch with you with pricing and delivery information in less than 12 hours.
Description: The complement is collected from healthy 8-12 week old rabbits (both male and female) and stored at -70°C. It is in the form of frozen liquid. The Hemolytic titer is LOT dependant but generally above 1:16. The complement is extremely heat-sensitive. Prior to working with it we recommend that the complement is thawed on ice or in a cold water bath or under a stream of cold water. Never thaw using warm or hot water. While defrosted like this we advise you to make single-use aliquots and keep them frozen at -70C. Freeze-thaw cycles will damage the complement components and will reduce significantly the activity. Once thawed, the leftover from a working aliquot should be discarded.
Rabbit Complement Adsorbed
31063-2 5mL
EUR 104
  • All products from Pel-Freez are available in Europe and worldwide via Gentaur. If you cannot find the item you need send us an inquiry and we will be in touch with you with pricing and delivery information in less than 12 hours.
Description: The complement is collected from healthy 8-12 week old rabbits (both male and female) and stored at -70°C. It is in the form of frozen liquid. The Hemolytic titer is LOT dependant but generally above 1:16. The complement is extremely heat-sensitive. Prior to working with it we recommend that the complement is thawed on ice or in a cold water bath or under a stream of cold water. Never thaw using warm or hot water. While defrosted like this we advise you to make single-use aliquots and keep them frozen at -70C. Freeze-thaw cycles will damage the complement components and will reduce significantly the activity. Once thawed, the leftover from a working aliquot should be discarded.
Rabbit Gamma Globulin
21005-2 10g
EUR 429
  • All products from Pel-Freez are available in Europe and worldwide via Gentaur. If you cannot find the item you need send us an inquiry and we will be in touch with you with pricing and delivery information in less than 12 hours.
Description: Rabbit gamma globulin is purified from serum obtained from normal healthy rabbits (male and female) by using various fractionation procedures. It is in lyophilized powder form with purity of 95% or more. Protein by weight: O.D. 280 nm E1%1.39: ? 85% - Residual salts, lipids, etc. comprise the rest of the weight.
Cyclooxygenase 2 Rabbit Polyclonal Conjugated Antibody
C38024 100ul
EUR 397
Rabbit Anti Ilp-2 Polyclonal Antibody
CPBT-66340RI 0.1 mg
EUR 580
Angiopoietin 2 (ANGPT2) Polyclonal Antibody (Rabbit)
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Leu230~Thr487
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Guinea polyclonal antibody against Rabbit Angiopoietin 2 (ANGPT2)
Anti-COX2/Cyclooxygenase 2/PTGS2 Antibody
A00084-2 100ug/vial
EUR 294
Anti-beta 2 Microglobulin/B2m Antibody
A00456-2 100ug/vial
EUR 294
Anti-VEGF Receptor 2/KDR Antibody
A00901-2 100ug/vial
EUR 334
Anti-Adiponectin Receptor 2 (mouse) Antibody
A02218-2 200ug
EUR 498
Description: Goat Polyclonal Adiponectin Receptor 2 (mouse) Antibody. Validated in IF, IHC and tested in Mouse.
Anti-Anterior Gradient 2/AGR2 Antibody
A02922-2 100ug/vial
EUR 334
Anti-p56Dok-2 (Ab-299) Antibody
A07956-2 100ul
EUR 397
Description: Rabbit Polyclonal p56Dok-2 (Ab-299) Antibody. Validated in IF, IHC, WB and tested in Human.
Anti-HIF-2-alpha/EPAS1 Antibody
PA1129-2 100ug/vial
EUR 294
Anti-Akt (E17K Mutant) Rabbit Monoclonal Antibody, Clone#RM336
M00024-2 50ug
EUR 513
Description: Anti-Akt (E17K Mutant) Rabbit Monoclonal Antibody, Clone#RM336 tested in IHC, ELISA, WB, reactive to Human
Anti-PD-1 (CD279) Rabbit Monoclonal Antibody, Clone#RM309
M00178-2 100uL
EUR 427
Description: Anti-PD-1 (CD279) Rabbit Monoclonal Antibody, Clone#RM309 tested in WB, IHC, reactive to Human
Anti-GST3/GST pi Rabbit Monoclonal Antibody, Clone#RM347
M00394-2 100uL
EUR 397
Description: Anti-GST3/GST pi Rabbit Monoclonal Antibody, Clone#RM347 tested in WB, IHC, reactive to Human

ERLIN1/2 Rabbit Polyclonal Antibody