ERLIN1/2 Rabbit Polyclonal Antibody

ERLIN1/2 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

ERLIN1/2 Polyclonal Antibody
46738-50ul 50ul
EUR 187
ERLIN1/2 Polyclonal Antibody
ABP57514-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from ERLIN1/2 at AA range: 31-80
  • Applications tips:
Description: A polyclonal antibody for detection of ERLIN1/2 from Human, Mouse, Rat. This ERLIN1/2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from ERLIN1/2 at AA range: 31-80
ERLIN1/2 Polyclonal Antibody
ABP57514-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from ERLIN1/2 at AA range: 31-80
  • Applications tips:
Description: A polyclonal antibody for detection of ERLIN1/2 from Human, Mouse, Rat. This ERLIN1/2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from ERLIN1/2 at AA range: 31-80
ERLIN1/2 Polyclonal Antibody
ABP57514-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from ERLIN1/2 at AA range: 31-80
  • Applications tips:
Description: A polyclonal antibody for detection of ERLIN1/2 from Human, Mouse, Rat. This ERLIN1/2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from ERLIN1/2 at AA range: 31-80
ERLIN1/2 Polyclonal Antibody
ES8507-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERLIN1/2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
ERLIN1/2 Polyclonal Antibody
ES8507-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERLIN1/2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
ERLIN1/2 Polyclonal Conjugated Antibody
C46738 100ul
EUR 397
ERLIN1 Polyclonal Antibody
28725-100ul 100ul
EUR 252
ERLIN1 Polyclonal Antibody
28725-50ul 50ul
EUR 187
ERLIN1 Polyclonal Antibody
A58954 100 µg
EUR 570.55
Description: reagents widely cited
ERLIN1 Rabbit pAb
A4440-100ul 100 ul
EUR 308
ERLIN1 Rabbit pAb
A4440-200ul 200 ul
EUR 459
ERLIN1 Rabbit pAb
A4440-20ul 20 ul Ask for price
ERLIN1 Rabbit pAb
A4440-50ul 50 ul Ask for price
ERLIN1 Rabbit pAb
A14843-100ul 100 ul
EUR 308
ERLIN1 Rabbit pAb
A14843-200ul 200 ul
EUR 459
ERLIN1 Rabbit pAb
A14843-20ul 20 ul
EUR 183
ERLIN1 Rabbit pAb
A14843-50ul 50 ul
EUR 223
ERLIN1 Polyclonal Conjugated Antibody
C32000 100ul
EUR 397
ERLIN1 Polyclonal Conjugated Antibody
C28725 100ul
EUR 397
Anti-ERLIN1/2 Antibody
A08034-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ERLIN1/2 Antibody (ERLIN1) detection.tested for IHC, WB in Human, Mouse, Rat.
Anti-ERLIN1/2 antibody
STJ98620 200 µl
EUR 197
Description: Rabbit polyclonal to ERLIN1/2.
Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit
DLR-ERLIN1-Hu-48T 48T
EUR 554
  • Should the Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ER Lipid Raft Associated Protein 1 (ERLIN1) in samples from tissue homogenates or other biological fluids.
Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit
DLR-ERLIN1-Hu-96T 96T
EUR 725
  • Should the Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ER Lipid Raft Associated Protein 1 (ERLIN1) in samples from tissue homogenates or other biological fluids.
Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit
RDR-ERLIN1-Hu-48Tests 48 Tests
EUR 589
Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit
RDR-ERLIN1-Hu-96Tests 96 Tests
EUR 820
Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit
RD-ERLIN1-Hu-48Tests 48 Tests
EUR 563
Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit
RD-ERLIN1-Hu-96Tests 96 Tests
EUR 783
ERLIN1 antibody
70R-17143 50 ul
EUR 435
Description: Rabbit polyclonal ERLIN1 antibody
ERLIN1 antibody
32000-100ul 100ul
EUR 252
ERLIN1 antibody
32000-50ul 50ul
EUR 187
ERLIN1 Antibody
DF12983 200ul
EUR 304
Description: ERLIN1 Antibody detects endogenous levels of ERLIN1.
ERLIN1 antibody
70R-7393 50 ug
EUR 467
Description: Rabbit polyclonal ERLIN1 antibody raised against the N terminal of ERLIN1
ERLIN1 Antibody
1-CSB-PA007790GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ERLIN1. Recognizes ERLIN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
ERLIN1 Antibody
1-CSB-PA007790LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERLIN1. Recognizes ERLIN1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200
ERLIN1 Polyclonal Antibody, Biotin Conjugated
A58955 100 µg
EUR 570.55
Description: Ask the seller for details
ERLIN1 Polyclonal Antibody, FITC Conjugated
A58956 100 µg
EUR 570.55
Description: The best epigenetics products
ERLIN1 Polyclonal Antibody, HRP Conjugated
A58957 100 µg
EUR 570.55
Description: kits suitable for this type of research
anti- ERLIN1 antibody
FNab02848 100µg
EUR 505.25
  • Immunogen: ER lipid raft associated 1
  • Uniprot ID: O75477
  • Gene ID: 10613
  • Research Area: Metabolism
Description: Antibody raised against ERLIN1
Anti-ERLIN1 antibody
PAab02848 100 ug
EUR 355
Anti-ERLIN1 antibody
STJ26674 100 µl
EUR 277
Description: The protein encoded by this gene is part of a protein complex that mediates degradation of inositol 1,4,5-trisphosphate receptors in the endoplasmic reticulum. The encoded protein also binds cholesterol and regulates the SREBP signaling pathway, which promotes cellular cholesterol homeostasis. Defects in this gene have been associated with spastic paraplegia 62.
Anti-ERLIN1 antibody
STJ117043 100 µl
EUR 277
Description: The protein encoded by this gene is part of a protein complex that mediates degradation of inositol 1,4,5-trisphosphate receptors in the endoplasmic reticulum. The encoded protein also binds cholesterol and regulates the SREBP signaling pathway, which promotes cellular cholesterol homeostasis. Defects in this gene have been associated with spastic paraplegia 62.
Rabbit Polyclonal Antibody to Human Topoisomerase I (Rabbit Serum)
TG2012-2 250 ul
EUR 380
Anti-Bcl-2 Rabbit Monoclonal Antibody
M00040-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Bcl-2 Antibody. Validated in IF, WB and tested in Human, Mouse.
ERLIN1 siRNA
20-abx915644
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ERLIN1 siRNA
20-abx915645
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ERLIN1 Antibody, HRP conjugated
1-CSB-PA007790LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERLIN1. Recognizes ERLIN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ERLIN1 Antibody, FITC conjugated
1-CSB-PA007790LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERLIN1. Recognizes ERLIN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ERLIN1 Antibody, Biotin conjugated
1-CSB-PA007790LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERLIN1. Recognizes ERLIN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Anti-KEO4 / ERLIN1 antibody
STJ71953 100 µg
EUR 359
Anti-COX-2 Rabbit Monoclonal Antibody, Clone#RM348
M00084-2 100uL
EUR 397
Description: Anti-COX-2 Rabbit Monoclonal Antibody, Clone#RM348 tested in WB, IHC, reactive to Human
ERLIN1 Blocking Peptide
33R-4577 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ERLIN1 antibody, catalog no. 70R-7393
ERLIN1 Blocking Peptide
DF12983-BP 1mg
EUR 195
ERLIN1 cloning plasmid
CSB-CL007790HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1041
  • Sequence: atgactcaagcccgggttctggtggctgcagtggtggggttggtggctgtcctgctctacgcctccatccacaagattgaggagggccatctggctgtgtactacaggggaggagctttactaactagccccagtggaccaggctatcatatcatgttgcctttcattactacgt
  • Show more
Description: A cloning plasmid for the ERLIN1 gene.
ERLIN1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0693103 1.0 ug DNA
EUR 154
Erlin1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6113603 1.0 ug DNA
EUR 154
Erlin1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4469603 1.0 ug DNA
EUR 154
Human ERLIN1 shRNA Plasmid
20-abx957226
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse ERLIN1 shRNA Plasmid
20-abx981462
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ERLIN1 Recombinant Protein (Human)
RP010903 100 ug Ask for price
ERLIN1 Recombinant Protein (Rat)
RP199907 100 ug Ask for price
ERLIN1 Recombinant Protein (Mouse)
RP132185 100 ug Ask for price
ERLIN1 Recombinant Protein (Mouse)
RP132188 100 ug Ask for price
ERLIN1 Recombinant Protein (Mouse)
RP132191 100 ug Ask for price
Anti-p53 Rabbit Monoclonal Antibody
M00001-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal p53 Antibody. Validated in ICC/IF, WB and tested in Human.
Anti-PTEN Rabbit Monoclonal Antibody
M00006-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal PTEN Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.
Anti-STAT3 Rabbit Monoclonal Antibody
M00007-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal STAT3 Antibody. Validated in IP, IF, WB and tested in Human.
Anti-Rb Rabbit Monoclonal Antibody
M00039-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Rb Antibody. Validated in IP, IF, WB and tested in Human, Mouse.
Anti-Ras Rabbit Monoclonal Antibody
M00099-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Ras Antibody. Validated in Flow Cytometry, IP, WB and tested in Human, Mouse, Rat.
Anti-ERK1 Rabbit Monoclonal Antibody
M00104-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal ERK1 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.
Anti-p21 Rabbit Monoclonal Antibody
M00145-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal p21 Antibody. Validated in IF, ICC, WB and tested in Human, Mouse, Rat.
Anti-p38 Rabbit Monoclonal Antibody
M00176-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal p38 Antibody. Validated in ChIP, IP, IF, WB and tested in Human, Mouse, Rat.
Anti-Rho Rabbit Monoclonal Antibody
M00207-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Rho Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.
Anti-GFAP Rabbit Monoclonal Antibody
M00213-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal GFAP Antibody. Validated in IF, IHC, WB and tested in Human, Rat.
Anti-LRRK2 Rabbit Monoclonal Antibody
M00221-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal LRRK2 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat.
Anti-MiTF Rabbit Monoclonal Antibody
M00269-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal MiTF Antibody. Validated in WB and tested in Human, Mouse, Rat.
Anti-PAX6 Rabbit Monoclonal Antibody
M00273-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal PAX6 Antibody. Validated in WB and tested in Human, Mouse, Rat.
Anti-MEK1 Rabbit Monoclonal Antibody
M00292-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal MEK1 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.
Anti-Survivin Rabbit Monoclonal Antibody
M00379-2 100ug/vial
EUR 397
Description: Anti-Survivin Rabbit Monoclonal Antibody tested for IP, IHC, WB in Mouse, Rat
Anti-Hsp27 Rabbit Monoclonal Antibody
M00676-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Hsp27 Antibody. Validated in Flow Cytometry and tested in Human, Mouse, Rat.
Anti-SOX10 Rabbit Monoclonal Antibody
M00758-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal SOX10 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.
Anti-PAX8 Rabbit Monoclonal Antibody
M00943-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal PAX8 Antibody. Validated in IF, WB and tested in Human.
Anti-PGP9.5 Rabbit Monoclonal Antibody
M01018-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal PGP9.5 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.
Anti-Podoplanin Rabbit Monoclonal Antibody
M01124-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Podoplanin Antibody. Validated in WB and tested in Human.
Anti-CD74 Rabbit Monoclonal Antibody
M01340-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD74 Antibody. Validated in IF, WB and tested in Human.
Anti-CD31 Rabbit Monoclonal Antibody
M01513-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD31 Antibody. Validated in WB and tested in Human.
Anti-Actin Rabbit Monoclonal Antibody
M02014-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Actin Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.
Anti-MBP Rabbit Monoclonal Antibody
M30934-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal MBP Antibody. Validated in WB and tested in All species.
Anti-GFP Rabbit Monoclonal Antibody
M30939-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal GFP Antibody. Validated in IF, IHC, ICC, WB and tested in Human, Mouse, Rat.
Cyclooxygenase 2 Rabbit Polyclonal Antibody
38024-100ul 100ul
EUR 252
Cyclooxygenase 2 Rabbit Polyclonal Antibody
38024-50ul 50ul
EUR 187
IGFBP-2 Polyclonal Antibody (Rabbit)
PAAI1 200 µg
EUR 299
Anti-Caspase-8 Rabbit Monoclonal Antibody
M00042-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Caspase-8 Antibody. Validated in ICC/IF, WB and tested in Human.
Anti-ER alpha Rabbit Monoclonal Antibody
M00057-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal ER alpha Antibody. Validated in ChIP, Flow Cytometry, IF, IHC, ICC, WB and tested in Canine, Human, Mouse, Rat.
Anti-Cleaved PARP Rabbit Monoclonal Antibody
M00122-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cleaved PARP Antibody. Validated in Flow Cytometry, IP, IF, ICC, WB and tested in Human.
Anti-CDK1/Cdc2 Rabbit Monoclonal Antibody
M00209-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal CDK1/Cdc2 Antibody. Validated in IP, IF, IHC, WB and tested in Human.
Anti-Androgen Receptor Rabbit Monoclonal Antibody
M00542-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Androgen Receptor Antibody. Validated in IF, IHC, ICC, WB and tested in Human, Mouse, Rat.
Anti-Cyclin B1 Rabbit Monoclonal Antibody
M00745-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cyclin B1 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse.
Anti-Liver Arginase Rabbit Monoclonal Antibody
M01106-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Liver Arginase Antibody. Validated in IP, IF, IHC, WB and tested in Human.

ERLIN1/2 Rabbit Polyclonal Antibody