MAD2L1BP Rabbit Polyclonal Antibody

MAD2L1BP Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

MAD2L1BP Polyclonal Antibody
ABP57070-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human MAD2L1BP at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of MAD2L1BP from Human. This MAD2L1BP antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human MAD2L1BP at AA range: 10-90
MAD2L1BP Polyclonal Antibody
ABP57070-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human MAD2L1BP at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of MAD2L1BP from Human. This MAD2L1BP antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human MAD2L1BP at AA range: 10-90
MAD2L1BP Polyclonal Antibody
ES8069-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MAD2L1BP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
MAD2L1BP Polyclonal Antibody
ES8069-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MAD2L1BP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
MAD2L1BP antibody
70R-18350 50 ul
EUR 435
Description: Rabbit polyclonal MAD2L1BP antibody
MAD2L1BP antibody
70R-10299 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MAD2L1BP antibody
MAD2L1BP Antibody
34774-100ul 100ul
EUR 252
MAD2L1BP Antibody
34774-50ul 50ul
EUR 187
MAD2L1BP Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MAD2L1BP. Recognizes MAD2L1BP from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
MAD2L1BP Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MAD2L1BP. Recognizes MAD2L1BP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300
MAD2L1BP Antibody
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MAD2L1BP. Recognizes MAD2L1BP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
MAD2L1BP Antibody
CSB-PA901414-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MAD2L1BP. Recognizes MAD2L1BP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
MAD2L1BP Antibody
DF4150 200ul
EUR 304
Description: MAD2L1BP Antibody detects endogenous levels of total MAD2L1BP.
MAD2L1BP Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MAD2L1BP. Recognizes MAD2L1BP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200
MAD2L1BP antibody
70R-35640 100 ug
EUR 327
Description: Rabbit polyclonal MAD2L1BP antibody
MAD2L1BP antibody
70R-50725 100 ul
EUR 244
Description: Purified Polyclonal MAD2L1BP antibody
MAD2L1BP Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MAD2L1BP. Recognizes MAD2L1BP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
MAD2L1BP Antibody
ABD4150 100 ug
EUR 438
Polyclonal MAD2L1BP antibody - N-terminal region
APR01476G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MAD2L1BP - N-terminal region. This antibody is tested and proven to work in the following applications:
MAD2L1BP Conjugated Antibody
C34774 100ul
EUR 397
anti- MAD2L1BP antibody
FNab04925 100µg
EUR 505.25
  • Immunogen: MAD2L1 binding protein
  • Uniprot ID: Q15013
  • Gene ID: 9587
  • Research Area: Cell Division and Proliferation
Description: Antibody raised against MAD2L1BP
Anti-MAD2L1BP antibody
PAab04925 100 ug
EUR 355
Anti-MAD2L1BP antibody
STJ93984 200 µl
EUR 197
Description: Rabbit polyclonal to MAD2L1BP.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Anti-MAD2L1BP/Mad2L1 Binding Protein Rabbit Monoclonal Antibody
M06825 100ug/vial
EUR 397
Description: Rabbit Monoclonal MAD2L1BP/Mad2L1 Binding Protein Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.
MAD2L1BP Blocking Peptide
33R-8289 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MAD2L1BP antibody, catalog no. 70R-10299
MAD2L1BP Blocking Peptide
DF4150-BP 1mg
EUR 195
MAD2L1BP Blocking Peptide
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
MAD2L1BP cloning plasmid
CSB-CL624009HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 825
  • Sequence: atggcggcgccggaggcggaggttctgtcctcagccgcagtccctgatttggagtggtatgagaagtccgaagaaactcacgcctcccagatagaactacttgagacaagctctacgcaggaacctctcaacgcttcggaggccttttgcccaagagactgcatggtaccagtggt
  • Show more
Description: A cloning plasmid for the MAD2L1BP gene.
MAD2L1 Binding Protein (MAD2L1BP) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
MAD2L1 Binding Protein (MAD2L1BP) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
MAD2L1 Binding Protein (MAD2L1BP) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
MAD2L1 Binding Protein (MAD2L1BP) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
MAD2L1 Binding Protein (MAD2L1BP) Antibody
abx145442-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
MAD2L1 Binding Protein (MAD2L1BP) Antibody
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
MAD2L1 Binding Protein (MAD2L1BP) Antibody
abx028995-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
MAD2L1 Binding Protein (MAD2L1BP) Antibody
abx028995-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
MAD2L1 Binding Protein (MAD2L1BP) Antibody
abx234925-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
MAD2L1 Binding Protein (MAD2L1BP) Antibody
abx331264-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
MAD2L1 Binding Protein (MAD2L1BP) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
MAD2L1BP protein (His tag)
80R-2185 50 ug
EUR 322
Description: Purified recombinant Human MAD2L1BP protein (His tag)
EF010780 96 Tests
EUR 689
Mouse MAD2L1BP shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human MAD2L1BP shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
MAD2L1BP Recombinant Protein (Human)
RP018568 100 ug Ask for price
MAD2L1BP Recombinant Protein (Mouse)
RP148898 100 ug Ask for price
MAD2L1BP Recombinant Protein (Rat)
RP210506 100 ug Ask for price
Anti-MAD2L1BP/Mad2L1 Binding Protein Antibody
A06825 100ul
EUR 397
Description: Rabbit Polyclonal MAD2L1BP/Mad2L1 Binding Protein Antibody. Validated in WB and tested in Human.
Monoclonal MAD2L1BP Antibody (monoclonal) (M03), Clone: 4G11
AMM03758G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human MAD2L1BP (monoclonal) (M03). The antibodies are raised in mouse and are from clone 4G11. This antibody is applicable in WB and IF, E
Mad2l1bp ORF Vector (Rat) (pORF)
ORF070170 1.0 ug DNA
EUR 506
MAD2L1BP ORF Vector (Human) (pORF)
ORF006190 1.0 ug DNA
EUR 95
Mad2l1bp ORF Vector (Mouse) (pORF)
ORF049634 1.0 ug DNA
EUR 506
Mad2l1bp sgRNA CRISPR Lentivector set (Rat)
K7461601 3 x 1.0 ug
EUR 339
Mad2l1bp sgRNA CRISPR Lentivector set (Mouse)
K4086901 3 x 1.0 ug
EUR 339
MAD2L1BP sgRNA CRISPR Lentivector set (Human)
K1251501 3 x 1.0 ug
EUR 339
Mouse MAD2L1- binding protein, Mad2l1bp ELISA KIT
ELI-19587m 96 Tests
EUR 865
Human MAD2L1- binding protein, MAD2L1BP ELISA KIT
ELI-42959h 96 Tests
EUR 824
Human MAD2L1 Binding Protein (MAD2L1BP) ELISA Kit
abx388370-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mad2l1bp sgRNA CRISPR Lentivector (Rat) (Target 1)
K7461602 1.0 ug DNA
EUR 154
Mad2l1bp sgRNA CRISPR Lentivector (Rat) (Target 2)
K7461603 1.0 ug DNA
EUR 154
Mad2l1bp sgRNA CRISPR Lentivector (Rat) (Target 3)
K7461604 1.0 ug DNA
EUR 154
Mad2l1bp sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4086902 1.0 ug DNA
EUR 154
Mad2l1bp sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4086903 1.0 ug DNA
EUR 154
Mad2l1bp sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4086904 1.0 ug DNA
EUR 154
MAD2L1BP sgRNA CRISPR Lentivector (Human) (Target 1)
K1251502 1.0 ug DNA
EUR 154
MAD2L1BP sgRNA CRISPR Lentivector (Human) (Target 2)
K1251503 1.0 ug DNA
EUR 154
MAD2L1BP sgRNA CRISPR Lentivector (Human) (Target 3)
K1251504 1.0 ug DNA
EUR 154
MAD2L1BP MAD2L1 Binding Protein Human Recombinant Protein
PROTQ15013 Regular: 10ug
EUR 317
Description: MAD2L1BP Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 298 amino acids (1-274 a.a) and having a molecular mass of 33.6kDa (Molecular weight on SDS-PAGE will appear higher).;MAD2L1BP is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
MAD2L1BP Protein Vector (Human) (pPB-C-His)
PV024757 500 ng
EUR 329
MAD2L1BP Protein Vector (Human) (pPB-N-His)
PV024758 500 ng
EUR 329
MAD2L1BP Protein Vector (Human) (pPM-C-HA)
PV024759 500 ng
EUR 329
MAD2L1BP Protein Vector (Human) (pPM-C-His)
PV024760 500 ng
EUR 329
MAD2L1BP Protein Vector (Rat) (pPB-C-His)
PV280678 500 ng
EUR 603
MAD2L1BP Protein Vector (Rat) (pPB-N-His)
PV280679 500 ng
EUR 603
MAD2L1BP Protein Vector (Rat) (pPM-C-HA)
PV280680 500 ng
EUR 603
MAD2L1BP Protein Vector (Rat) (pPM-C-His)
PV280681 500 ng
EUR 603
MAD2L1BP Protein Vector (Mouse) (pPB-C-His)
PV198534 500 ng
EUR 603
MAD2L1BP Protein Vector (Mouse) (pPB-N-His)
PV198535 500 ng
EUR 603
MAD2L1BP Protein Vector (Mouse) (pPM-C-HA)
PV198536 500 ng
EUR 603
MAD2L1BP Protein Vector (Mouse) (pPM-C-His)
PV198537 500 ng
EUR 603
Recombinant Human MAD2L1BP Protein, His, E.coli-10ug
QP12617-10ug 10ug
EUR 201
Recombinant Human MAD2L1BP Protein, His, E.coli-1mg
QP12617-1mg 1mg
EUR 5251
Recombinant Human MAD2L1BP Protein, His, E.coli-2ug
QP12617-2ug 2ug
EUR 155
Mad2l1bp 3'UTR Luciferase Stable Cell Line
TU112779 1.0 ml Ask for price
Mad2l1bp 3'UTR GFP Stable Cell Line
TU162779 1.0 ml Ask for price
Mad2l1bp 3'UTR Luciferase Stable Cell Line
TU212743 1.0 ml Ask for price
Mad2l1bp 3'UTR GFP Stable Cell Line
TU262743 1.0 ml Ask for price
MAD2L1BP 3'UTR GFP Stable Cell Line
TU062833 1.0 ml
EUR 1521
MAD2L1BP 3'UTR Luciferase Stable Cell Line
TU012833 1.0 ml
EUR 1521
MAD2L1BP Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV637279 1.0 ug DNA
EUR 514
MAD2L1BP Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV637283 1.0 ug DNA
EUR 514
MAD2L1BP Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV637284 1.0 ug DNA
EUR 514
ELISA kit for Mouse MAD2L1-binding protein (MAD2L1BP)
KTE71145-48T 48T
EUR 332
  • MAD2L1BPwas identified as a binding protein of the MAD2 mitotic arrest deficient-like 1 (MAD2/MAD2L1). This protein may interact with the spindle checkpoint and coordinate cell cycle events in late mitosis. Alternatively spliced transcript variants e
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse MAD2L1-binding protein (MAD2L1BP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

MAD2L1BP Rabbit Polyclonal Antibody