RIN1 Rabbit Polyclonal Antibody

RIN1 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RIN1 Polyclonal Antibody

ABP57074-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human RIN1 at AA range: 630-710
  • Applications tips:
Description: A polyclonal antibody for detection of RIN1 from Human, Mouse, Rat. This RIN1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human RIN1 at AA range: 630-710

RIN1 Polyclonal Antibody

ABP57074-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human RIN1 at AA range: 630-710
  • Applications tips:
Description: A polyclonal antibody for detection of RIN1 from Human, Mouse, Rat. This RIN1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human RIN1 at AA range: 630-710

RIN1 Polyclonal Antibody

ABP57074-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human RIN1 at AA range: 630-710
  • Applications tips:
Description: A polyclonal antibody for detection of RIN1 from Human, Mouse, Rat. This RIN1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human RIN1 at AA range: 630-710

RIN1 Polyclonal Antibody

A68695 100 ?g
EUR 628.55
Description: The best epigenetics products

RIN1 (RIN1) Antibody

20-abx124480
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

RIN1 (RIN1) Antibody

20-abx008405
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

RIN1 (RIN1) Antibody

abx237306-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RIN1 Rabbit pAb

A13791-100ul 100 ul
EUR 308

RIN1 Rabbit pAb

A13791-200ul 200 ul
EUR 459

RIN1 Rabbit pAb

A13791-20ul 20 ul
EUR 183

RIN1 Rabbit pAb

A13791-50ul 50 ul
EUR 223

RIN1 Rabbit pAb

A9184-100ul 100 ul
EUR 308

RIN1 Rabbit pAb

A9184-200ul 200 ul
EUR 459

RIN1 Rabbit pAb

A9184-20ul 20 ul Ask for price

RIN1 Rabbit pAb

A9184-50ul 50 ul Ask for price

RIN1 antibody

70R-50727 100 ul
EUR 244
Description: Purified Polyclonal RIN1 antibody

RIN1 Antibody

ABD4384 100 ug
EUR 438

RIN1 Antibody

34961-100ul 100ul
EUR 252

RIN1 Antibody

34961-50ul 50ul
EUR 187

RIN1 antibody

70R-19898 50 ul
EUR 435
Description: Rabbit polyclonal RIN1 antibody

RIN1 Antibody

DF4384 200ul
EUR 304
Description: RIN1 Antibody detects endogenous levels of total RIN1.

RIN1 Antibody

CSB-PA580053-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RIN1. Recognizes RIN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RIN1 Antibody

CSB-PA580053-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RIN1. Recognizes RIN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RIN1 Antibody

1-CSB-PA080037
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RIN1. Recognizes RIN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

RIN1 Antibody

1-CSB-PA019726GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RIN1. Recognizes RIN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RIN1 Antibody

1-CSB-PA019726LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIN1. Recognizes RIN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

Polyclonal HUMAN-RIN1(Y36) Antibody

APR04704G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HUMAN-RIN1(Y36) . This antibody is tested and proven to work in the following applications:

RIN1 Polyclonal Antibody, HRP Conjugated

A68696 100 ?g
EUR 628.55
Description: kits suitable for this type of research

RIN1 Polyclonal Antibody, FITC Conjugated

A68697 100 ?g
EUR 628.55
Description: fast delivery possible

RIN1 Polyclonal Antibody, Biotin Conjugated

A68698 100 ?g
EUR 628.55
Description: reagents widely cited

Rin1/ Rat Rin1 ELISA Kit

ELI-30288r 96 Tests
EUR 886

RIN1 Conjugated Antibody

C34961 100ul
EUR 397

anti- RIN1 antibody

FNab07306 100µg
EUR 548.75
  • Immunogen: Ras and Rab interactor 1
  • Uniprot ID: Q13671
  • Gene ID: 9610
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against RIN1

Anti-RIN1 Antibody

A04953 100ul
EUR 397
Description: Rabbit Polyclonal RIN1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-RIN1 antibody

PAab07306 100 ug
EUR 386

Anti-RIN1 antibody

STJ95509 200 µl
EUR 197
Description: Rabbit polyclonal to RIN1.

Anti-RIN1 antibody

STJ111603 100 µl
EUR 277

Anti-RIN1 antibody

STJ115736 100 µl
EUR 277

RIN1 siRNA

20-abx904584
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RIN1 siRNA

20-abx931544
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RIN1 siRNA

20-abx931545
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RIN1

YF-PA16430 50 ug
EUR 363
Description: Mouse polyclonal to RIN1

anti-RIN1

YF-PA16431 100 ug
EUR 403
Description: Rabbit polyclonal to RIN1

anti-RIN1

YF-PA27449 100 ul
EUR 403
Description: Rabbit polyclonal to RIN1

anti-RIN1

YF-PA25379 50 ul
EUR 334
Description: Mouse polyclonal to RIN1

RIN1 Antibody, HRP conjugated

1-CSB-PA019726LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIN1. Recognizes RIN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RIN1 Antibody, FITC conjugated

1-CSB-PA019726LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIN1. Recognizes RIN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RIN1 Antibody, Biotin conjugated

1-CSB-PA019726LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIN1. Recognizes RIN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RIN1 cloning plasmid

CSB-CL019726HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2352
  • Sequence: atggaaagccctggagagtcaggcgcgggctctcctggagcccccagcccgtccagcttcactactgggcacctggcgagagaaaagccagcccaggacccactgtatgacgtgcccaatgccagcggcgggcaggcaggcgggccgcagcggccggggcgcgttgtgagcctgc
  • Show more
Description: A cloning plasmid for the RIN1 gene.

RIN1 Blocking Peptide

20-abx063602
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RIN1 Blocking Peptide

DF4384-BP 1mg
EUR 195

Anti-RIN1 (1D11)

YF-MA16947 100 ug
EUR 363
Description: Mouse monoclonal to RIN1

Mouse RIN1 shRNA Plasmid

20-abx981430
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RIN1 shRNA Plasmid

20-abx987894
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RIN1 ELISA KIT|Human

EF002475 96 Tests
EUR 689

Human RIN1 shRNA Plasmid

20-abx956394
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RIN1 Recombinant Protein (Human)

RP026467 100 ug Ask for price

RIN1 Recombinant Protein (Rat)

RP226148 100 ug Ask for price

RIN1 Recombinant Protein (Mouse)

RP168248 100 ug Ask for price

Monoclonal RIN1 Antibody (monoclonal) (M01), Clone: 1D11

AMM04013G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RIN1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1D11. This antibody is applicable in E

Ras And Rab Interactor 1 (RIN1) Antibody

20-abx014784
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Ras And Rab Interactor 1 (RIN1) Antibody

20-abx327803
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ras And Rab Interactor 1 (RIN1) Antibody

abx332716-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Ras And Rab Interactor 1 (RIN1) Antibody

20-abx333743
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RIN1 ORF Vector (Human) (pORF)

ORF008823 1.0 ug DNA
EUR 95

Rin1 ORF Vector (Mouse) (pORF)

ORF056084 1.0 ug DNA
EUR 506

Rin1 ORF Vector (Rat) (pORF)

ORF075384 1.0 ug DNA
EUR 506

Ras And Rab Interactor 1 (RIN1) Antibody (HRP)

20-abx337420
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ras And Rab Interactor 1 (RIN1) Antibody (FITC)

20-abx337421
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ras And Rab Interactor 1 (RIN1) Antibody (Biotin)

20-abx337422
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RIN1 sgRNA CRISPR Lentivector set (Human)

K1824901 3 x 1.0 ug
EUR 339

Rin1 sgRNA CRISPR Lentivector set (Mouse)

K3564301 3 x 1.0 ug
EUR 339

Rin1 sgRNA CRISPR Lentivector set (Rat)

K7032901 3 x 1.0 ug
EUR 339

RIN1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1824902 1.0 ug DNA
EUR 154

RIN1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1824903 1.0 ug DNA
EUR 154

RIN1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1824904 1.0 ug DNA
EUR 154

Rin1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3564302 1.0 ug DNA
EUR 154

Rin1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3564303 1.0 ug DNA
EUR 154

Rin1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3564304 1.0 ug DNA
EUR 154

Rin1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7032902 1.0 ug DNA
EUR 154

Rin1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7032903 1.0 ug DNA
EUR 154

Rin1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7032904 1.0 ug DNA
EUR 154

RIN1 Protein Vector (Human) (pPB-C-His)

PV035289 500 ng
EUR 329

RIN1 Protein Vector (Human) (pPB-N-His)

PV035290 500 ng
EUR 329

RIN1 Protein Vector (Human) (pPM-C-HA)

PV035291 500 ng
EUR 329

RIN1 Protein Vector (Human) (pPM-C-His)

PV035292 500 ng
EUR 329

RIN1 Protein Vector (Rat) (pPB-C-His)

PV301534 500 ng
EUR 1166

RIN1 Protein Vector (Rat) (pPB-N-His)

PV301535 500 ng
EUR 1166

RIN1 Protein Vector (Rat) (pPM-C-HA)

PV301536 500 ng
EUR 1166

RIN1 Protein Vector (Rat) (pPM-C-His)

PV301537 500 ng
EUR 1166

RIN1 Protein Vector (Mouse) (pPB-C-His)

PV224334 500 ng
EUR 1065

RIN1 Protein Vector (Mouse) (pPB-N-His)

PV224335 500 ng
EUR 1065

RIN1 Protein Vector (Mouse) (pPM-C-HA)

PV224336 500 ng
EUR 1065

RIN1 Protein Vector (Mouse) (pPM-C-His)

PV224337 500 ng
EUR 1065

Rin1 3'UTR GFP Stable Cell Line

TU167894 1.0 ml Ask for price

RIN1 3'UTR Luciferase Stable Cell Line

TU019927 1.0 ml
EUR 1394

Rin1 3'UTR Luciferase Stable Cell Line

TU117894 1.0 ml Ask for price

RIN1 3'UTR GFP Stable Cell Line

TU069927 1.0 ml
EUR 1394

RIN1 Rabbit Polyclonal Antibody