FAM48A Rabbit Polyclonal Antibody

FAM48A Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

FAM48A Polyclonal Antibody

ABP57553-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 231-280
  • Applications tips:
Description: A polyclonal antibody for detection of FAM48A from Human, Mouse, Rat. This FAM48A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 231-280

FAM48A Polyclonal Antibody

ES8546-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FAM48A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FAM48A Polyclonal Antibody

ES8546-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FAM48A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Fam48a/ Rat Fam48a ELISA Kit

ELI-09774r 96 Tests
EUR 886

Anti-FAM48A Antibody

A11433 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for FAM48A Antibody (SUPT20H) detection. Tested with WB in Human, Mouse, Rat.

anti- FAM48A antibody

FNab02986 100µg
EUR 585
  • Immunogen: family with sequence similarity 48, member A
  • Uniprot ID: Q8NEM7
  • Research Area: Developmental biology
Description: Antibody raised against FAM48A

Anti-FAM48A antibody

PAab02986 100 ug
EUR 412

Anti-FAM48A antibody

STJ98659 200 µl
EUR 197
Description: Rabbit polyclonal to FAM48A.

Human Protein FAM48A, FAM48A ELISA KIT

ELI-09807h 96 Tests
EUR 824

Chicken Protein FAM48A, FAM48A ELISA KIT

ELI-47764c 96 Tests
EUR 928

Mouse Protein FAM48A, Fam48a ELISA KIT

ELI-47765m 96 Tests
EUR 865

FAM48A cloning plasmid

CSB-CL818775HU-10ug 10ug
EUR 765
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2340
  • Sequence: atgcaacaagctttagaactagctttggatcgtgcagagtatgtcattgaaagtgcccgacagagacctcctaaaaggaaatacctatcaagtggaagaaaatctgtatttcaaaaactttatgacttgtatattgaagaatgtgaaaaagaacctgaagttaagaaattaagaa
  • Show more
Description: A cloning plasmid for the FAM48A gene.


EF009537 96 Tests
EUR 689

FAM48A Recombinant Protein (Human)

RP011569 100 ug Ask for price

FAM48A Recombinant Protein (Rat)

RP200663 100 ug Ask for price

FAM48A Recombinant Protein (Mouse)

RP133427 100 ug Ask for price

Fam48a ORF Vector (Rat) (pORF)

ORF066889 1.0 ug DNA
EUR 506

FAM48A ORF Vector (Human) (pORF)

ORF003857 1.0 ug DNA
EUR 95

Fam48a ORF Vector (Mouse) (pORF)

ORF044477 1.0 ug DNA
EUR 506

FAM48A sgRNA CRISPR Lentivector set (Human)

K0723901 3 x 1.0 ug
EUR 339

Fam48a sgRNA CRISPR Lentivector set (Mouse)

K4815301 3 x 1.0 ug
EUR 339

Fam48a sgRNA CRISPR Lentivector set (Rat)

K6431301 3 x 1.0 ug
EUR 339

Family With Sequence Similarity 48 Member A (FAM48A) Antibody

abx340073-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Family With Sequence Similarity 48 Member A (FAM48A) Antibody

abx232986-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

FAM48A sgRNA CRISPR Lentivector (Human) (Target 1)

K0723902 1.0 ug DNA
EUR 154

FAM48A sgRNA CRISPR Lentivector (Human) (Target 2)

K0723903 1.0 ug DNA
EUR 154

FAM48A sgRNA CRISPR Lentivector (Human) (Target 3)

K0723904 1.0 ug DNA
EUR 154

Fam48a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4815302 1.0 ug DNA
EUR 154

Fam48a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4815303 1.0 ug DNA
EUR 154

Fam48a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4815304 1.0 ug DNA
EUR 154

Fam48a sgRNA CRISPR Lentivector (Rat) (Target 1)

K6431302 1.0 ug DNA
EUR 154

Fam48a sgRNA CRISPR Lentivector (Rat) (Target 2)

K6431303 1.0 ug DNA
EUR 154

Fam48a sgRNA CRISPR Lentivector (Rat) (Target 3)

K6431304 1.0 ug DNA
EUR 154

FAM48A Protein Vector (Mouse) (pPB-C-His)

PV177906 500 ng
EUR 603

FAM48A Protein Vector (Mouse) (pPB-N-His)

PV177907 500 ng
EUR 603

FAM48A Protein Vector (Mouse) (pPM-C-HA)

PV177908 500 ng
EUR 603

FAM48A Protein Vector (Mouse) (pPM-C-His)

PV177909 500 ng
EUR 603

FAM48A Protein Vector (Rat) (pPB-C-His)

PV267554 500 ng
EUR 603

FAM48A Protein Vector (Rat) (pPB-N-His)

PV267555 500 ng
EUR 603

FAM48A Protein Vector (Rat) (pPM-C-HA)

PV267556 500 ng
EUR 603

FAM48A Protein Vector (Rat) (pPM-C-His)

PV267557 500 ng
EUR 603

FAM48A Protein Vector (Human) (pPB-C-His)

PV015425 500 ng
EUR 329

FAM48A Protein Vector (Human) (pPB-N-His)

PV015426 500 ng
EUR 329

FAM48A Protein Vector (Human) (pPM-C-HA)

PV015427 500 ng
EUR 329

FAM48A Protein Vector (Human) (pPM-C-His)

PV015428 500 ng
EUR 329

Fam48a 3'UTR GFP Stable Cell Line

TU156273 1.0 ml Ask for price

Fam48a 3'UTR Luciferase Stable Cell Line

TU106273 1.0 ml Ask for price

Fam48a 3'UTR Luciferase Stable Cell Line

TU204372 1.0 ml Ask for price

Fam48a 3'UTR GFP Stable Cell Line

TU254372 1.0 ml Ask for price

FAM48A 3'UTR GFP Stable Cell Line

TU057328 1.0 ml
EUR 1394

FAM48A 3'UTR Luciferase Stable Cell Line

TU007328 1.0 ml
EUR 1394

FAM48A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV658225 1.0 ug DNA
EUR 682

FAM48A Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV658229 1.0 ug DNA
EUR 682

FAM48A Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV658230 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

FAM48A Rabbit Polyclonal Antibody