HAO1 Rabbit Polyclonal Antibody

HAO1 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

HAO1 Polyclonal Antibody

ABP57253-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of HAO1 from Mouse, Rat. This HAO1 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

HAO1 Polyclonal Antibody

ABP57253-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of HAO1 from Mouse, Rat. This HAO1 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

HAO1 Polyclonal Antibody

ABP57253-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of HAO1 from Mouse, Rat. This HAO1 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

HAO1 Polyclonal Antibody

A69311 100 ?g
EUR 628.55
Description: reagents widely cited

HAO1 Rabbit pAb

A6470-100ul 100 ul
EUR 308

HAO1 Rabbit pAb

A6470-200ul 200 ul
EUR 459

HAO1 Rabbit pAb

A6470-20ul 20 ul
EUR 183

HAO1 Rabbit pAb

A6470-50ul 50 ul
EUR 223

Polyclonal HAO1 Antibody (Center)

AMM05297G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HAO1 (Center). This antibody is tested and proven to work in the following applications:

HAO1/GOX Polyclonal Antibody

EA223-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HAO1/GOX from Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC

HAO1/GOX Polyclonal Antibody

EA223-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HAO1/GOX from Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC

HAO1 antibody

70R-3102 50 ug
EUR 467
Description: Rabbit polyclonal HAO1 antibody

HAO1 antibody

38946-100ul 100ul
EUR 252

HAO1 Antibody

43063-100ul 100ul
EUR 252

HAO1 antibody

10R-4292 100 ul
EUR 691
Description: Mouse monoclonal HAO1 antibody

HAO1 antibody

10R-4293 100 ul
EUR 691
Description: Mouse monoclonal HAO1 antibody

HAO1 antibody

10R-4294 100 ul
EUR 691
Description: Mouse monoclonal HAO1 antibody

HAO1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HAO1. Recognizes HAO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

HAO1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against HAO1. Recognizes HAO1 from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:2000-5000

HAO1 Polyclonal Antibody, HRP Conjugated

A69312 100 ?g
EUR 628.55
Description: Ask the seller for details

HAO1 Polyclonal Antibody, FITC Conjugated

A69313 100 ?g
EUR 628.55
Description: The best epigenetics products

HAO1 Polyclonal Antibody, Biotin Conjugated

A69314 100 ?g
EUR 628.55
Description: kits suitable for this type of research

HAO1 Conjugated Antibody

C38946 100ul
EUR 397

HAO1 Conjugated Antibody

C43063 100ul
EUR 397

anti- HAO1 antibody

FNab03752 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: hydroxyacid oxidase (glycolate oxidase) 1
  • Uniprot ID: Q9UJM8
  • Gene ID: 54363
  • Research Area: Metabolism
Description: Antibody raised against HAO1

HAO1 Monoclonal Antibody

ABM40189-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A monoclonal antibody for detection of HAO1 from Mouse, Rat. This HAO1 antibody is for WB, IHC-P, IF. It is affinity-purified from mouse ascites by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

HAO1 Monoclonal Antibody

ABM40189-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A monoclonal antibody for detection of HAO1 from Mouse, Rat. This HAO1 antibody is for WB, IHC-P, IF. It is affinity-purified from mouse ascites by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

HAO1 Monoclonal Antibody

ABM40189-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A monoclonal antibody for detection of HAO1 from Mouse, Rat. This HAO1 antibody is for WB, IHC-P, IF. It is affinity-purified from mouse ascites by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

HAO1 Monoclonal Antibody

40484-100ul 100ul
EUR 252

HAO1 Monoclonal Antibody

40484-50ul 50ul
EUR 187

Anti-HAO1 antibody

PAab03752 100 ug
EUR 412

Anti-HAO1 antibody

STJ97395 200 µl
EUR 197
Description: HAO1 is a protein encoded by the HAO1 gene which is approximately 40,9 kDa. HAO1 is localised to the peroxisome. It is involved in carbon metabolism, glyoxylate metabolism and glycine degradation. It has 2-hydroxy-acid oxidase activity and is most active on the 2-carbon substrate glycolate, but is also active on 2-hydroxy fatty acids, with high activity towards 2-hydroxy palmitate and 2-hydroxy octanoate. HAO1 is expressed in the liver. Mutations in the HAO1 gene may result in primary hyperoxaluria. STJ97395 was developed from clone Mix and was affinity-purified from mouse ascites by affinity-chromatography using epitope-specific immunogen. The antibody detects endogenous HAO1 protein.

Anti-HAO1 antibody

STJ97454 200 µl
EUR 197
Description: Rabbit polyclonal to HAO1.

Anti-HAO1 antibody

STJ28553 100 µl
EUR 277
Description: This gene is one of three related genes that have 2-hydroxyacid oxidase activity yet differ in encoded protein amino acid sequence, tissue expression and substrate preference. Subcellular location of the encoded protein is the peroxisome. Specifically, this gene is expressed primarily in liver and pancreas and the encoded protein is most active on glycolate, a two-carbon substrate. The protein is also active on 2-hydroxy fatty acids. The transcript detected at high levels in pancreas may represent an alternatively spliced form or the use of a multiple near-consensus upstream polyadenylation site.

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Gly102~Lys357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1)

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Gly102~Lys357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1)


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA19286 50 ul
EUR 363
Description: Mouse polyclonal to HAO1


YF-PA19287 100 ug
EUR 403
Description: Rabbit polyclonal to HAO1


YF-PA27564 50 ug
EUR 363
Description: Mouse polyclonal to HAO1

HAO1/GOX Monoclonal Antibody

EM1180-100ul 100ul
EUR 279
Description: A Mouse Monoclonal antibody against HAO1/GOX from Rat/ Mouse. This antibody is tested and validated for WB, ELISA

HAO1/GOX Monoclonal Antibody

EM1180-50ul 50ul
EUR 207
Description: A Mouse Monoclonal antibody against HAO1/GOX from Rat/ Mouse. This antibody is tested and validated for WB, ELISA

HAO1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HAO1. Recognizes HAO1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HAO1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HAO1. Recognizes HAO1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HAO1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HAO1. Recognizes HAO1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Mouse, Rat)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Ser113~Lys369)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Hydroxyacid Oxidase 1 (HAO1)

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Gly102~Lys357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with APC.

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Gly102~Lys357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with Biotin.

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Gly102~Lys357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with Cy3.

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Gly102~Lys357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with FITC.

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Gly102~Lys357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with HRP.

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Gly102~Lys357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with PE.

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Gly102~Lys357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with APC.

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Gly102~Lys357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with Biotin.

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Gly102~Lys357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with Cy3.

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Gly102~Lys357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with FITC.

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Gly102~Lys357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with HRP.

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Gly102~Lys357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with PE.

HAO1 Blocking Peptide

33R-3411 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HAO1 antibody, catalog no. 70R-3102

HAO1 cloning plasmid

CSB-CL891938HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1113
  • Sequence: atgctcccccggctaatttgtatcaatgattatgaacaacatgctaaatcagtacttccaaagtctatatatgactattacaggtctggggcaaatgatgaagaaactttggctgataatattgcagcattttccagatggaagctgtatccaaggatgctccggaatgttgctg
  • Show more
Description: A cloning plasmid for the HAO1 gene.

Hydroxyacid Oxidase 1 (HAO1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hydroxyacid Oxidase 1 (HAO1) Antibody

  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hydroxyacid Oxidase 1 (HAO1) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Hydroxyacid Oxidase 1 (HAO1) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Hydroxyacid Oxidase 1 (HAO1) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hydroxyacid Oxidase 1 (HAO1) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hydroxyacid Oxidase 1 (HAO1) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hydroxyacid Oxidase 1 (HAO1) Antibody

abx034021-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Hydroxyacid Oxidase 1 (HAO1) Antibody

abx034021-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Hydroxyacid Oxidase 1 (HAO1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hydroxyacid Oxidase 1 (HAO1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hydroxyacid Oxidase 1 (HAO1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hydroxyacid Oxidase 1 (HAO1) Antibody

abx233752-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Mouse, Rat), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Ser113~Lys369)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with APC.

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Mouse, Rat), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Ser113~Lys369)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with Biotin.

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Mouse, Rat), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Ser113~Lys369)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with Cy3.

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Mouse, Rat), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Ser113~Lys369)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with FITC.

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Mouse, Rat), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Ser113~Lys369)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with HRP.

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Mouse, Rat), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Ser113~Lys369)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with PE.

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Gly102~Lys357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with APC-Cy7.

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Gly102~Lys357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with APC-Cy7.

Hydroxyacid Oxidase 1 (HAO1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hydroxyacid Oxidase 1 (HAO1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hydroxyacid Oxidase 1 (HAO1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-HAO1/Hydroxyacid Oxidase 1 Antibody

A09159 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for HAO1 Antibody (HAO1) detection.tested for WB in Mouse, Rat.

Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Mouse, Rat), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HAO1 (Ser113~Lys369)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with APC-Cy7.


EF010058 96 Tests
EUR 689

Human HAO1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HAO1 protein (His tag)

80R-1929 100 ug
EUR 305
Description: Purified recombinant HAO1 protein

Mouse HAO1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HAO1 Recombinant Protein (Human)

RP039715 100 ug Ask for price

HAO1 Recombinant Protein (Rat)

RP204179 100 ug Ask for price

HAO1 Recombinant Protein (Mouse)

RP140900 100 ug Ask for price

Mouse Hydroxyacid oxidase 1 (Hao1)

  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 45 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Hydroxyacid oxidase 1(Hao1) expressed in E.coli

Hao1 ORF Vector (Rat) (pORF)

ORF068061 1.0 ug DNA
EUR 506

Hao1 ORF Vector (Mouse) (pORF)

ORF046968 1.0 ug DNA
EUR 506

HAO1 ORF Vector (Human) (pORF)

ORF013239 1.0 ug DNA
EUR 354

Recombinant Hydroxyacid Oxidase 1 (HAO1)

  • EUR 496.03
  • EUR 236.00
  • EUR 1585.12
  • EUR 595.04
  • EUR 1090.08
  • EUR 395.00
  • EUR 3812.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9WU19
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 60.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Hydroxyacid Oxidase 1 expressed in: E.coli

Recombinant Hydroxyacid Oxidase 1 (HAO1)

  • EUR 583.84
  • EUR 259.00
  • EUR 1914.40
  • EUR 704.80
  • EUR 1309.60
  • EUR 454.00
  • EUR 4636.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: B0BNF9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.7kDa
  • Isoelectric Point: 5.9
Description: Recombinant Rat Hydroxyacid Oxidase 1 expressed in: E.coli

Recombinant Hydroxyacid Oxidase 1 (HAO1)

  • EUR 583.84
  • EUR 259.00
  • EUR 1914.40
  • EUR 704.80
  • EUR 1309.60
  • EUR 454.00
  • EUR 4636.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: B0BNF9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Hydroxyacid Oxidase 1 expressed in: E.coli

HAO1 ELISA Kit (Mouse) (OKCA00899)

OKCA00899 96 Wells
EUR 833
Description: Description of target: Has 2-hydroxyacid oxidase activity. Most active on the 2-carbon substrate glycolate, but is also active on 2-hydroxy fatty acids, with high activity towards 2-hydroxy palmitate and 2-hydroxy octanoate.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.56 pg/mL

HAO1 sgRNA CRISPR Lentivector set (Human)

K0928501 3 x 1.0 ug
EUR 339

Rat Hydroxyacid Oxidase 1 (HAO1) Protein

  • EUR 815.00
  • EUR 314.00
  • EUR 2569.00
  • EUR 968.00
  • EUR 565.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Hydroxyacid Oxidase 1 (HAO1) Protein

  • EUR 815.00
  • EUR 314.00
  • EUR 2569.00
  • EUR 968.00
  • EUR 565.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

HAO1 Rabbit Polyclonal Antibody