EDA Rabbit Polyclonal Antibody

EDA Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

EDA Polyclonal Antibody

ABP57390-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human EDA
  • Applications tips:
Description: A polyclonal antibody for detection of EDA from Human, Mouse. This EDA antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human EDA

EDA Polyclonal Antibody

ABP57390-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human EDA
  • Applications tips:
Description: A polyclonal antibody for detection of EDA from Human, Mouse. This EDA antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human EDA

EDA Polyclonal Antibody

ABP57390-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human EDA
  • Applications tips:
Description: A polyclonal antibody for detection of EDA from Human, Mouse. This EDA antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human EDA

EDA Rabbit pAb

A2905-100ul 100 ul
EUR 308

EDA Rabbit pAb

A2905-200ul 200 ul
EUR 459

EDA Rabbit pAb

A2905-20ul 20 ul
EUR 183

EDA Rabbit pAb

A2905-50ul 50 ul
EUR 223

EDA Antibody

ABD7103 100 ug
EUR 438

EDA Antibody

36433-100ul 100ul
EUR 252

EDA antibody

38491-100ul 100ul
EUR 252

EDA Antibody

DF7103 200ul
EUR 304
Description: EDA Antibody detects endogenous levels of total EDA.

EDA Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EDA. Recognizes EDA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC-p:1:100-1:300.ELISA:1/10000

EDA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDA. Recognizes EDA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

EDA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDA. Recognizes EDA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

EDA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDA. Recognizes EDA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:500-1:5000, WB:1:100-1:500

EDA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDA. Recognizes EDA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

Polyclonal EDA / ED1 Antibody (Internal)

AMM06998G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EDA / ED1 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal EDA Antibody (N-term)

AMM06999G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EDA (N-term). This antibody is tested and proven to work in the following applications:


  • EUR 272.00
  • EUR 1107.00
  • EUR 481.00
  • 1 g
  • 25 g
  • 5 g
  • Shipped within 1-2 weeks.

Ectodysplasin A (EDA) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDA (Pro141~Thr378)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA)

EDA Conjugated Antibody

C36433 100ul
EUR 397

Anti-EDA Antibody

PB9191 100ug/vial
EUR 294

Anti-EDA Antibody

PA1561 100ug/vial
EUR 294

Anti-EDA antibody

STJ97656 200 µl
EUR 197
Description: Rabbit polyclonal to EDA.

Anti-EDA antibody

STJ23467 100 µl
EUR 277
Description: The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene.

Ectodysplasin A (EDA) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDA (Pro141~Thr378)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA). This antibody is labeled with APC.

Ectodysplasin A (EDA) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDA (Pro141~Thr378)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA). This antibody is labeled with Biotin.

Ectodysplasin A (EDA) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDA (Pro141~Thr378)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA). This antibody is labeled with Cy3.

Ectodysplasin A (EDA) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDA (Pro141~Thr378)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA). This antibody is labeled with FITC.

Ectodysplasin A (EDA) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDA (Pro141~Thr378)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA). This antibody is labeled with HRP.

Ectodysplasin A (EDA) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDA (Pro141~Thr378)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA). This antibody is labeled with PE.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Ectodysplasin A (EDA) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ectodysplasin A (EDA) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Ectodysplasin A (EDA) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ectodysplasin A (EDA) Antibody

abx032775-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ectodysplasin A (EDA) Antibody

abx032775-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

EDA- A1 Receptor Antibody

ABD9056 100 ug
EUR 438

Ectodysplasin A (EDA) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ectodysplasin A (EDA) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ectodysplasin A (EDA) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ectodysplasin A (EDA) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ectodysplasin A (EDA) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

EDA-A1 Receptor Antibody

45677-100ul 100ul
EUR 252

EDA-A1 Receptor Antibody

45677-50ul 50ul
EUR 187

EDA-A1 Receptor Antibody

DF9056 200ul
EUR 304
Description: EDA-A1 Receptor Antibody detects endogenous levels of total EDA-A1 Receptor.

Ectodysplasin A (EDA) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDA (Pro141~Thr378)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA). This antibody is labeled with APC-Cy7.

EDA Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.


5-02221 250mg Ask for price


5-02222 1g Ask for price

EDA cloning plasmid

CSB-CL856433HU-10ug 10ug
EUR 439
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1176
  • Sequence: atgggctacccggaggtggagcgcagggaactcctgcctgcagcagcgccgcgggagcgagggagccagggctgcgggtgtggcggggcccctgcccgggcgggcgaagggaacagctgcctgctcttcctgggtttctttggcctctcgctggccctccacctgctgacgttgt
  • Show more
Description: A cloning plasmid for the EDA gene.

EDA Blocking Peptide

DF7103-BP 1mg
EUR 195

Recombinant human EDA

P1422 100ug Ask for price
  • Uniprot ID: Q92838
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human EDA


EUR 153


EUR 430

EDA-A1 Receptor Conjugated Antibody

C45677 100ul
EUR 397

EDA-A1 Receptor (EDAR) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.


ELA-E1976h 96 Tests
EUR 824


EF006123 96 Tests
EUR 689

Human EDA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EDA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Ectodysplasin A (EDA)

  • EUR 637.60
  • EUR 274.00
  • EUR 2116.00
  • EUR 772.00
  • EUR 1444.00
  • EUR 490.00
  • EUR 5140.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O54693
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Ectodysplasin A expressed in: E.coli

EDA Recombinant Protein (Human)

RP038695 100 ug Ask for price

EDA Rabbit Polyclonal Antibody