Rec8 Rabbit Polyclonal Antibody

Rec8 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

Rec8 Polyclonal Antibody

ABP57152-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Rec8 at AA range: 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of Rec8 from Human. This Rec8 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Rec8 at AA range: 130-210

REC8 Rabbit pAb

A15002-100ul 100 ul
EUR 308

REC8 Rabbit pAb

A15002-200ul 200 ul
EUR 459

REC8 Rabbit pAb

A15002-20ul 20 ul
EUR 183

REC8 Rabbit pAb

A15002-50ul 50 ul
EUR 223

REC8 Rabbit pAb

A8660-100ul 100 ul
EUR 308

REC8 Rabbit pAb

A8660-200ul 200 ul
EUR 459

REC8 Rabbit pAb

A8660-20ul 20 ul
EUR 183

REC8 Rabbit pAb

A8660-50ul 50 ul
EUR 223

Polyclonal REC8 Antibody (Center)

APR03837G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human REC8 (Center). This antibody is tested and proven to work in the following applications:

REC8 Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

REC8 Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rec8 antibody

70R-5548 50 ug
EUR 467
Description: Rabbit polyclonal Rec8 antibody

REC8 antibody

70R-35357 100 ug
EUR 327
Description: Purified Rabbit polyclonal REC8 antibody

REC8 Antibody

ABD4155 100 ug
EUR 438

REC8 Antibody

34779-100ul 100ul
EUR 252

REC8 Antibody

34779-50ul 50ul
EUR 187

REC8 Antibody

43324-100ul 100ul
EUR 252

REC8 antibody

70R-19844 50 ul
EUR 435
Description: Rabbit polyclonal REC8 antibody

REC8 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against REC8. Recognizes REC8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

REC8 Antibody

CSB-PA939960-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against REC8. Recognizes REC8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

REC8 Antibody

DF4155 200ul
EUR 304
Description: REC8 Antibody detects endogenous levels of total REC8.

REC8 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against REC8. Recognizes REC8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

REC8 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against REC8. Recognizes REC8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:20-1:100

REC8 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against REC8. Recognizes REC8 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

REC8 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against REC8. Recognizes REC8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

REC8 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against REC8. Recognizes REC8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

REC8 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against REC8. Recognizes REC8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Meiotic Recombination Protein REC8 Homolog (REC8) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Meiotic Recombination Protein REC8 Homolog (REC8) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Meiotic Recombination Protein REC8 Homolog (REC8) Antibody

abx145147-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Meiotic Recombination Protein REC8 Homolog (REC8) Antibody

abx027474-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Meiotic Recombination Protein REC8 Homolog (REC8) Antibody

abx027474-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Meiotic Recombination Protein REC8 Homolog (REC8) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Meiotic recombination protein REC8 homolog (REC8) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Meiotic Recombination Protein REC8 Homolog (REC8) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Meiotic Recombination Protein REC8 Homolog (REC8) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Meiotic recombination protein REC8 homolog (REC8) Antibody

abx331124-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Meiotic Recombination Protein REC8 Homolog (REC8) Antibody

abx237223-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

REC8 Conjugated Antibody

C43324 100ul
EUR 397

REC8 Conjugated Antibody

C34779 100ul
EUR 397

anti- REC8 antibody

FNab07223 100µg
EUR 548.75
  • Immunogen: REC8 homolog(yeast)
  • Uniprot ID: O95072
  • Gene ID: 9985
  • Research Area: Cell Division and Proliferation, Metabolism, Developmental biology
Description: Antibody raised against REC8

Anti-REC8 Antibody

A04915 100ul
EUR 397
Description: Rabbit Polyclonal REC8 Antibody. Validated in WB and tested in Human.

Anti-REC8 antibody

PAab07223 100 ug
EUR 386

Anti-Rec8 antibody

STJ95400 200 µl
EUR 197
Description: Rabbit polyclonal to Rec8.

Anti-REC8 antibody

STJ111370 100 µl
EUR 277
Description: This gene encodes a member of the kleisin family of SMC (structural maintenance of chromosome) protein partners. The protein localizes to the axial elements of chromosomes during meiosis in both oocytes and spermatocytes. In the mouse, the homologous protein is a key component of the meiotic cohesion complex, which regulates sister chromatid cohesion and recombination between homologous chromosomes. Multiple alternatively spliced variants, encoding the same protein, have been found for this gene.

Anti-REC8 antibody

STJ117199 100 µl
EUR 277
Description: This gene encodes a member of the kleisin family of SMC (structural maintenance of chromosome) protein partners. The protein localizes to the axial elements of chromosomes during meiosis in both oocytes and spermatocytes. In the mouse, the homologous protein is a key component of the meiotic cohesion complex, which regulates sister chromatid cohesion and recombination between homologous chromosomes. Multiple alternatively spliced variants, encoding the same protein, have been found for this gene.

Rec8/ Rat Rec8 ELISA Kit

ELI-30116r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT18502 2 ug
EUR 231

REC8 cloning plasmid

CSB-CL019535HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1644
  • Sequence: atgttctactatcccaacgtgcttcagcgccacaccggctgctttgccaccatctggctggcggcgactcgcggcagccggttggtgaagcgcgaatacctgagggtgaatgtggtgaaaacctgcgaggaaatcctcaattacgtgctggtacgagtgcaacccccgcagcccg
  • Show more
Description: A cloning plasmid for the REC8 gene.

REC8 cloning plasmid

CSB-CL019535HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1644
  • Sequence: atgttctactatcccaacgtgcttcagcgccacaccggctgctttgccaccatctggctggcggcgactcgcggcagccggttggtgaagcgcgaatacctgagggtgaatgtggtgaaaacctgcgaggaaatcctcaattacgtgctggtacgagtgcaacccccgcagcccg
  • Show more
Description: A cloning plasmid for the REC8 gene.

Rec8 Blocking Peptide

33R-7641 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of REC8 antibody, catalog no. 70R-5548

REC8 Blocking Peptide

DF4155-BP 1mg
EUR 195

Human Meiotic recombination protein REC8 homolog (REC8) ELISA Kit

abx555922-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Meiotic recombination protein REC8 homolog (REC8) ELISA Kit

abx556140-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Meiotic recombination protein REC8 homolog (REC8) ELISA Kit

abx556269-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Rec8/ Meiotic recombination protein REC8 homolog ELISA Kit

E0834Ra 1 Kit
EUR 646

Rec8 ELISA Kit| Rat Meiotic recombination protein REC8 homolog

EF019257 96 Tests
EUR 689

Mouse Rec8/ Meiotic recombination protein REC8 homolog ELISA Kit

E1250Mo 1 Kit
EUR 632

Human REC8/ Meiotic recombination protein REC8 homolog ELISA Kit

E2133Hu 1 Kit
EUR 605

Rec8 ELISA Kit| Mouse Meiotic recombination protein REC8 homolo

EF016063 96 Tests
EUR 689

Mouse Meiotic recombination protein REC8 homolog, Rec8 ELISA KIT

ELI-52249m 96 Tests
EUR 865

Human Meiotic recombination protein REC8 homolog, REC8 ELISA KIT

ELI-38881h 96 Tests
EUR 824

Mouse REC8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat REC8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF002402 96 Tests
EUR 689

Human REC8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

REC8 Recombinant Protein (Human)

RP026122 100 ug Ask for price

REC8 Recombinant Protein (Human)

RP026125 100 ug Ask for price

REC8 Recombinant Protein (Rat)

RP224009 100 ug Ask for price

REC8 Recombinant Protein (Mouse)

RP167492 100 ug Ask for price

REC8 ORF Vector (Human) (pORF)

ORF008708 1.0 ug DNA
EUR 95

REC8 ORF Vector (Human) (pORF)

ORF008709 1.0 ug DNA
EUR 95

Rec8 ORF Vector (Rat) (pORF)

ORF074671 1.0 ug DNA
EUR 506

Rec8 ORF Vector (Mouse) (pORF)

ORF055832 1.0 ug DNA
EUR 506

REC8 ELISA Kit (Human) (OKEH03329)

OKEH03329 96 Wells
EUR 727
Description: Description of target: Required during meiosis for separation of sister chromatids and homologous chromosomes. Proteolytic cleavage of REC8 on chromosome arms by separin during anaphase I allows for homologous chromosome separation in meiosis I and cleavage of REC8 on centromeres during anaphase II allows for sister chromatid separation in meiosis II.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.39 ng/mL

REC8 sgRNA CRISPR Lentivector set (Human)

K1806001 3 x 1.0 ug
EUR 339

Rec8 sgRNA CRISPR Lentivector set (Mouse)

K3355001 3 x 1.0 ug
EUR 339

Rec8 sgRNA CRISPR Lentivector set (Rat)

K6482701 3 x 1.0 ug
EUR 339

REC8 sgRNA CRISPR Lentivector (Human) (Target 1)

K1806002 1.0 ug DNA
EUR 154

REC8 sgRNA CRISPR Lentivector (Human) (Target 2)

K1806003 1.0 ug DNA
EUR 154

REC8 sgRNA CRISPR Lentivector (Human) (Target 3)

K1806004 1.0 ug DNA
EUR 154

Rec8 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3355002 1.0 ug DNA
EUR 154

Rec8 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3355003 1.0 ug DNA
EUR 154

Rec8 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3355004 1.0 ug DNA
EUR 154

Rec8 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6482702 1.0 ug DNA
EUR 154

Rec8 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6482703 1.0 ug DNA
EUR 154

Rec8 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6482704 1.0 ug DNA
EUR 154

REC8 Protein Vector (Human) (pPB-C-His)

PV034829 500 ng
EUR 329

REC8 Protein Vector (Human) (pPB-N-His)

PV034830 500 ng
EUR 329

REC8 Protein Vector (Human) (pPM-C-HA)

PV034831 500 ng
EUR 329

REC8 Protein Vector (Human) (pPM-C-His)

PV034832 500 ng
EUR 329

REC8 Protein Vector (Human) (pPB-C-His)

PV034833 500 ng
EUR 329

REC8 Protein Vector (Human) (pPB-N-His)

PV034834 500 ng
EUR 329

REC8 Protein Vector (Human) (pPM-C-HA)

PV034835 500 ng
EUR 329

REC8 Protein Vector (Human) (pPM-C-His)

PV034836 500 ng
EUR 329

REC8 Protein Vector (Rat) (pPB-C-His)

PV298682 500 ng
EUR 603

REC8 Protein Vector (Rat) (pPB-N-His)

PV298683 500 ng
EUR 603

REC8 Protein Vector (Rat) (pPM-C-HA)

PV298684 500 ng
EUR 603

REC8 Protein Vector (Rat) (pPM-C-His)

PV298685 500 ng
EUR 603

REC8 Protein Vector (Mouse) (pPB-C-His)

PV223326 500 ng
EUR 603

REC8 Protein Vector (Mouse) (pPB-N-His)

PV223327 500 ng
EUR 603

REC8 Protein Vector (Mouse) (pPM-C-HA)

PV223328 500 ng
EUR 603

REC8 Protein Vector (Mouse) (pPM-C-His)

PV223329 500 ng
EUR 603

Rec8 3'UTR GFP Stable Cell Line

TU167694 1.0 ml Ask for price

REC8 3'UTR Luciferase Stable Cell Line

TU019724 1.0 ml
EUR 1394

Rec8 3'UTR Luciferase Stable Cell Line

TU117694 1.0 ml Ask for price

REC8 3'UTR GFP Stable Cell Line

TU069724 1.0 ml
EUR 1394

Rec8 3'UTR GFP Stable Cell Line

TU267450 1.0 ml Ask for price

Rec8 3'UTR Luciferase Stable Cell Line

TU217450 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

Rec8 Rabbit Polyclonal Antibody