Rec8 Rabbit Polyclonal Antibody

Rec8 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

Rec8 Polyclonal Antibody
ES8151-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Rec8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

REC8 Rabbit pAb
A8660-100ul 100 ul
EUR 308

REC8 Rabbit pAb
A8660-200ul 200 ul
EUR 459

REC8 Rabbit pAb
A8660-20ul 20 ul
EUR 183

REC8 Rabbit pAb
A8660-50ul 50 ul
EUR 223

REC8 Rabbit pAb
A15002-100ul 100 ul
EUR 308

REC8 Rabbit pAb
A15002-200ul 200 ul
EUR 459

REC8 Rabbit pAb
A15002-20ul 20 ul
EUR 183

REC8 Rabbit pAb
A15002-50ul 50 ul
EUR 223

Polyclonal REC8 Antibody (Center)
APR03837G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human REC8 (Center). This antibody is tested and proven to work in the following applications:

REC8 antibody
70R-19844 50 ul
EUR 435
Description: Rabbit polyclonal REC8 antibody

REC8 Antibody
34779-100ul 100ul
EUR 252

REC8 Antibody
34779-50ul 50ul
EUR 187

REC8 Antibody
43324-100ul 100ul
EUR 252

REC8 Antibody
1-CSB-PA080116
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against REC8. Recognizes REC8 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

REC8 Antibody
CSB-PA939960-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against REC8. Recognizes REC8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

REC8 Antibody
CSB-PA939960-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against REC8. Recognizes REC8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

REC8 Antibody
1-CSB-PA778066
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against REC8. Recognizes REC8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

REC8 Antibody
DF4155 200ul
EUR 304
Description: REC8 Antibody detects endogenous levels of total REC8.

REC8 Antibody
1-CSB-PA570897
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against REC8. Recognizes REC8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:20-1:100

REC8 antibody
70R-35357 100 ug
EUR 327
Description: Purified Rabbit polyclonal REC8 antibody

Rec8 antibody
70R-5548 50 ug
EUR 467
Description: Rabbit polyclonal Rec8 antibody

REC8 Antibody
20-abx211787
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

REC8 Antibody
20-abx212565
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

REC8 Antibody
1-CSB-PA019535ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against REC8. Recognizes REC8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

REC8 Antibody
1-CSB-PA019535ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against REC8. Recognizes REC8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

REC8 Antibody
1-CSB-PA019535GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against REC8. Recognizes REC8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

REC8 Antibody
ABD4155 100 ug
EUR 438

Meiotic Recombination Protein REC8 Homolog (REC8) Antibody
abx027474-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Meiotic Recombination Protein REC8 Homolog (REC8) Antibody
abx027474-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Meiotic Recombination Protein REC8 Homolog (REC8) Antibody
20-abx115079
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Meiotic Recombination Protein REC8 Homolog (REC8) Antibody
20-abx123912
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Meiotic Recombination Protein REC8 Homolog (REC8) Antibody
abx145147-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Meiotic Recombination Protein REC8 Homolog (REC8) Antibody
20-abx014573
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Meiotic Recombination Protein REC8 Homolog (REC8) Antibody
20-abx321200
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Meiotic Recombination Protein REC8 Homolog (REC8) Antibody
abx237223-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Meiotic recombination protein REC8 homolog (REC8) Antibody
abx331124-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Meiotic recombination protein REC8 homolog (REC8) Antibody
20-abx324072
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Meiotic Recombination Protein REC8 Homolog (REC8) Antibody
20-abx322017
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-REC8 Antibody
A04915 100ul
EUR 397
Description: Rabbit Polyclonal REC8 Antibody. Validated in WB and tested in Human.

REC8 Conjugated Antibody
C43324 100ul
EUR 397

REC8 Conjugated Antibody
C34779 100ul
EUR 397

anti- REC8 antibody
FNab07223 100µg
EUR 548.75
  • Immunogen: REC8 homolog(yeast)
  • Uniprot ID: O95072
  • Gene ID: 9985
  • Research Area: Cell Division and Proliferation, Metabolism, Developmental biology
Description: Antibody raised against REC8

Anti-REC8 antibody
PAab07223 100 ug
EUR 386

Anti-REC8 antibody
STJ111370 100 µl
EUR 277
Description: This gene encodes a member of the kleisin family of SMC (structural maintenance of chromosome) protein partners. The protein localizes to the axial elements of chromosomes during meiosis in both oocytes and spermatocytes. In the mouse, the homologous protein is a key component of the meiotic cohesion complex, which regulates sister chromatid cohesion and recombination between homologous chromosomes. Multiple alternatively spliced variants, encoding the same protein, have been found for this gene.

Anti-REC8 antibody
STJ117199 100 µl
EUR 277
Description: This gene encodes a member of the kleisin family of SMC (structural maintenance of chromosome) protein partners. The protein localizes to the axial elements of chromosomes during meiosis in both oocytes and spermatocytes. In the mouse, the homologous protein is a key component of the meiotic cohesion complex, which regulates sister chromatid cohesion and recombination between homologous chromosomes. Multiple alternatively spliced variants, encoding the same protein, have been found for this gene.

Anti-Rec8 antibody
STJ95400 200 µl
EUR 197
Description: Rabbit polyclonal to Rec8.

Rec8/ Rat Rec8 ELISA Kit
ELI-30116r 96 Tests
EUR 886

REC8 siRNA
20-abx904520
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

REC8 siRNA
20-abx931206
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

REC8 siRNA
20-abx931207
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-REC8
PVT18502 2 ug
EUR 231

Rec8 Blocking Peptide
33R-7641 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of REC8 antibody, catalog no. 70R-5548

REC8 Blocking Peptide
DF4155-BP 1mg
EUR 195

REC8 cloning plasmid
CSB-CL019535HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1644
  • Sequence: atgttctactatcccaacgtgcttcagcgccacaccggctgctttgccaccatctggctggcggcgactcgcggcagccggttggtgaagcgcgaatacctgagggtgaatgtggtgaaaacctgcgaggaaatcctcaattacgtgctggtacgagtgcaacccccgcagcccg
  • Show more
Description: A cloning plasmid for the REC8 gene.

REC8 cloning plasmid
CSB-CL019535HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1644
  • Sequence: atgttctactatcccaacgtgcttcagcgccacaccggctgctttgccaccatctggctggcggcgactcgcggcagccggttggtgaagcgcgaatacctgagggtgaatgtggtgaaaacctgcgaggaaatcctcaattacgtgctggtacgagtgcaacccccgcagcccg
  • Show more
Description: A cloning plasmid for the REC8 gene.

Rat Rec8/ Meiotic recombination protein REC8 homolog ELISA Kit
E0834Ra 1 Kit
EUR 646

Mouse Rec8/ Meiotic recombination protein REC8 homolog ELISA Kit
E1250Mo 1 Kit
EUR 632

Human REC8/ Meiotic recombination protein REC8 homolog ELISA Kit
E2133Hu 1 Kit
EUR 605

Rec8 ELISA Kit| Rat Meiotic recombination protein REC8 homolog
EF019257 96 Tests
EUR 689

Rec8 ELISA Kit| Mouse Meiotic recombination protein REC8 homolo
EF016063 96 Tests
EUR 689

Mouse Meiotic recombination protein REC8 homolog, Rec8 ELISA KIT
ELI-52249m 96 Tests
EUR 865

Human Meiotic recombination protein REC8 homolog (REC8) ELISA Kit
abx555922-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Meiotic recombination protein REC8 homolog (REC8) ELISA Kit
abx556140-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Meiotic recombination protein REC8 homolog (REC8) ELISA Kit
abx556269-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Meiotic recombination protein REC8 homolog, REC8 ELISA KIT
ELI-38881h 96 Tests
EUR 824

REC8 ELISA KIT|Human
EF002402 96 Tests
EUR 689

Rat REC8 shRNA Plasmid
20-abx988425
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse REC8 shRNA Plasmid
20-abx974887
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human REC8 shRNA Plasmid
20-abx956717
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

REC8 Recombinant Protein (Human)
RP026122 100 ug Ask for price

REC8 Recombinant Protein (Human)
RP026125 100 ug Ask for price

REC8 Recombinant Protein (Mouse)
RP167492 100 ug Ask for price

REC8 Recombinant Protein (Rat)
RP224009 100 ug Ask for price

Rec8 ORF Vector (Rat) (pORF)
ORF074671 1.0 ug DNA
EUR 506

REC8 ORF Vector (Human) (pORF)
ORF008708 1.0 ug DNA
EUR 95

REC8 ORF Vector (Human) (pORF)
ORF008709 1.0 ug DNA
EUR 95

Rec8 ORF Vector (Mouse) (pORF)
ORF055832 1.0 ug DNA
EUR 506

REC8 ELISA Kit (Human) (OKEH03329)
OKEH03329 96 Wells
EUR 727
Description: Description of target: Required during meiosis for separation of sister chromatids and homologous chromosomes. Proteolytic cleavage of REC8 on chromosome arms by separin during anaphase I allows for homologous chromosome separation in meiosis I and cleavage of REC8 on centromeres during anaphase II allows for sister chromatid separation in meiosis II.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.39 ng/mL

Rec8 sgRNA CRISPR Lentivector set (Rat)
K6482701 3 x 1.0 ug
EUR 339

REC8 sgRNA CRISPR Lentivector set (Human)
K1806001 3 x 1.0 ug
EUR 339

Rec8 sgRNA CRISPR Lentivector set (Mouse)
K3355001 3 x 1.0 ug
EUR 339

Rec8 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6482702 1.0 ug DNA
EUR 154

Rec8 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6482703 1.0 ug DNA
EUR 154

Rec8 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6482704 1.0 ug DNA
EUR 154

REC8 sgRNA CRISPR Lentivector (Human) (Target 1)
K1806002 1.0 ug DNA
EUR 154

REC8 sgRNA CRISPR Lentivector (Human) (Target 2)
K1806003 1.0 ug DNA
EUR 154

REC8 sgRNA CRISPR Lentivector (Human) (Target 3)
K1806004 1.0 ug DNA
EUR 154

Rec8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3355002 1.0 ug DNA
EUR 154

Rec8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3355003 1.0 ug DNA
EUR 154

Rec8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3355004 1.0 ug DNA
EUR 154

REC8 Protein Vector (Rat) (pPB-C-His)
PV298682 500 ng
EUR 603

REC8 Protein Vector (Rat) (pPB-N-His)
PV298683 500 ng
EUR 603

REC8 Protein Vector (Rat) (pPM-C-HA)
PV298684 500 ng
EUR 603

REC8 Protein Vector (Rat) (pPM-C-His)
PV298685 500 ng
EUR 603

REC8 Protein Vector (Human) (pPB-C-His)
PV034829 500 ng
EUR 329

Rec8 Rabbit Polyclonal Antibody