FXR2 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

FXR2 Polyclonal Antibody
ES8049-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against FXR2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

FXR2 Polyclonal Antibody
ABP57050-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the C-terminal region of human FXR2 at AA range: 520-600 Applications tips:
Description: A polyclonal antibody for detection of FXR2 from Human, Mouse. This FXR2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human FXR2 at AA range: 520-600

FXR2 Polyclonal Antibody
ABP57050-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the C-terminal region of human FXR2 at AA range: 520-600 Applications tips:
Description: A polyclonal antibody for detection of FXR2 from Human, Mouse. This FXR2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human FXR2 at AA range: 520-600

FXR2 Polyclonal Antibody
ABP57050-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the C-terminal region of human FXR2 at AA range: 520-600 Applications tips:
Description: A polyclonal antibody for detection of FXR2 from Human, Mouse. This FXR2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human FXR2 at AA range: 520-600

FXR2 Rabbit pAb
A4313-100ul	Abclonal	100 ul	EUR 308

FXR2 Rabbit pAb
A4313-200ul	Abclonal	200 ul	EUR 459

FXR2 Rabbit pAb
A4313-20ul	Abclonal	20 ul	EUR 183

FXR2 Rabbit pAb
A4313-50ul	Abclonal	50 ul	EUR 223

FXR2 Rabbit pAb
A14092-100ul	Abclonal	100 ul	EUR 308

FXR2 Rabbit pAb
A14092-200ul	Abclonal	200 ul	EUR 459

FXR2 Rabbit pAb
A14092-20ul	Abclonal	20 ul	EUR 183

FXR2 Rabbit pAb
A14092-50ul	Abclonal	50 ul	EUR 223

FXR2 antibody
70R-50717	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal FXR2 antibody

FXR2 antibody
70R-4723	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal FXR2 antibody raised against the middle region of FXR2

FXR2 antibody
70R-31745	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal FXR2 antibody

FXR2 Antibody
ABD3195	Lifescience Market	100 ug	EUR 438

FXR2 Antibody
33793-100ul	SAB	100ul	EUR 252

FXR2 Antibody
33793-50ul	SAB	50ul	EUR 187

FXR2 antibody
70R-17374	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal FXR2 antibody

FXR2 Antibody
CSB-PA870516-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against FXR2. Recognizes FXR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

FXR2 Antibody
CSB-PA870516-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against FXR2. Recognizes FXR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

FXR2 Antibody
DF3195	Affbiotech	200ul	EUR 304
Description: FXR2 Antibody detects endogenous levels of total FXR2.

FXR2 Antibody
1-CSB-PA009088GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FXR2. Recognizes FXR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FXR2 Antibody
1-CSB-PA080013	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FXR2. Recognizes FXR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

FXR2 Conjugated Antibody
C33793	SAB	100ul	EUR 397

anti- FXR2 antibody
FNab03257	FN Test	100µg	EUR 505.25
Immunogen: fragile X mental retardation, autosomal homolog 2 Uniprot ID: P51116 Gene ID: 9513 Research Area: Neuroscience, Metabolism
Description: Antibody raised against FXR2

Anti-FXR2 antibody
PAab03257	Lifescience Market	100 ug	EUR 355

Anti-FXR2 antibody
STJ93168	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to FXR2.

Anti-FXR2 antibody
STJ23723	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a RNA binding protein containing two KH domains and one RCG box, which is similar to FMRP and FXR1. It associates with polyribosomes, predominantly with 60S large ribosomal subunits. This encoded protein may self-associate or interact with FMRP and FXR1. It may have a role in the development of fragile X mental retardation syndrome.

Anti-FXR2 antibody
STJ116027	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a RNA binding protein containing two KH domains and one RCG box, which is similar to FMRP and FXR1. It associates with polyribosomes, predominantly with 60S large ribosomal subunits. This encoded protein may self-associate or interact with FMRP and FXR1. It may have a role in the development of fragile X mental retardation syndrome.

FXR2 siRNA
20-abx917333	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pEGFP- FXR2
PVT10262	Lifescience Market	2 ug	EUR 301

anti-FXR2
YF-PA16355	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to FXR2

anti-FXR2
YF-PA16356	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to FXR2

anti-FXR2
YF-PA16357	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to FXR2

FXR2 cloning plasmid
CSB-CL009088HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2022 Sequence: atgggcggcctggcctctgggggggatgtggagccgggactgcccgtcgaggtgcgcggctccaacggggccttctacaagggctttgtgaaggatgtccatgaagactctgtcaccatcttctttgaaaacaactggcagagtgagagacaaattccttttggggatgtccggc Show more
Description: A cloning plasmid for the FXR2 gene.

FXR2 cloning plasmid
CSB-CL009088HU2-10ug	Cusabio	10ug	EUR 675
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2022 Sequence: atgggcggcctggcctctgggggggatgtggagccgggactgcccgtcgaggtgcgcggctccaacggggccttctacaagggctttgtgaaggatgtccatgaagactctgtcaccatcttctttgaaaacaactggcagagtgagagacaaattccttttggggatgtccggc Show more
Description: A cloning plasmid for the FXR2 gene.

FXR2 Blocking Peptide
20-abx063592	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

FXR2 Blocking Peptide
33R-7935	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FXR2 antibody, catalog no. 70R-4723

FXR2 Blocking Peptide
DF3195-BP	Affbiotech	1mg	EUR 195

FXR2 ELISA KIT|Human
EF009720	Lifescience Market	96 Tests	EUR 689

Human FXR2 ELISA KIT
ELI-30809h	Lifescience Market	96 Tests	EUR 824

Mouse Fxr2 ELISA KIT
ELI-30810m	Lifescience Market	96 Tests	EUR 865

Human FXR2 shRNA Plasmid
20-abx956319	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FXR2 Recombinant Protein (Human)
RP012688	ABM	100 ug	Ask for price

FXR2 Recombinant Protein (Human)
RP012691	ABM	100 ug	Ask for price

FXR2 Recombinant Protein (Rat)
RP201920	ABM	100 ug	Ask for price

FXR2 Recombinant Protein (Mouse)
RP135473	ABM	100 ug	Ask for price

FXR2 ORF Vector (Human) (pORF)
ORF004230	ABM	1.0 ug DNA	EUR 95

FXR2 ORF Vector (Human) (pORF)
ORF004231	ABM	1.0 ug DNA	EUR 95

Fxr2 ORF Vector (Rat) (pORF)
ORF067308	ABM	1.0 ug DNA	EUR 506

Fxr2 ORF Vector (Mouse) (pORF)
ORF045159	ABM	1.0 ug DNA	EUR 506

Fxr2 sgRNA CRISPR Lentivector set (Mouse)
K4381101	ABM	3 x 1.0 ug	EUR 339

Fxr2 sgRNA CRISPR Lentivector set (Rat)
K6104101	ABM	3 x 1.0 ug	EUR 339

FXR2 sgRNA CRISPR Lentivector set (Human)
K0823801	ABM	3 x 1.0 ug	EUR 339

Monoclonal FXR2 Antibody (aa414-658, clone 1G2), Clone: 1G2
APG03296G	Leading Biology	0.05ml	EUR 484
Description: A Monoclonal antibody against Human FXR2 (aa414-658, clone 1G2). The antibodies are raised in Mouse and are from clone 1G2. This antibody is applicable in WB and IHC-P

Fragile X Mental Retardation, Autosomal Homolog 2 (FXR2) Antibody
20-abx112591	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Fragile X Mental Retardation, Autosomal Homolog 2 (FXR2) Antibody
abx122505-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Fragile X Mental Retardation, Autosomal Homolog 2 (FXR2) Antibody
20-abx003205	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Fragile X Mental Retardation, Autosomal Homolog 2 (FXR2) Antibody
20-abx013513	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Fragile X Mental Retardation, Autosomal Homolog 2 (FXR2) Antibody
20-abx008414	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Fragile X Mental Retardation, Autosomal Homolog 2 (FXR2) Antibody
20-abx326061	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Fragile X Mental Retardation, Autosomal Homolog 2 (FXR2) Antibody
abx331510-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Fragile X Mental Retardation, Autosomal Homolog 2 (FXR2) Antibody
abx233257-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Fxr2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4381102	ABM	1.0 ug DNA	EUR 154

Fxr2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4381103	ABM	1.0 ug DNA	EUR 154

Fxr2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4381104	ABM	1.0 ug DNA	EUR 154

Fxr2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6104102	ABM	1.0 ug DNA	EUR 154

Fxr2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6104103	ABM	1.0 ug DNA	EUR 154

Fxr2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6104104	ABM	1.0 ug DNA	EUR 154

FXR2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0823802	ABM	1.0 ug DNA	EUR 154

FXR2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0823803	ABM	1.0 ug DNA	EUR 154

FXR2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0823804	ABM	1.0 ug DNA	EUR 154

FXR2 Protein Vector (Rat) (pPB-C-His)
PV269230	ABM	500 ng	EUR 1166

FXR2 Rabbit Polyclonal Antibody