COX5a Rabbit Polyclonal Antibody

COX5a Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

COX5a Polyclonal Antibody

ABP57030-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human COX5a at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of COX5a from Human, Mouse, Rat. This COX5a antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COX5a at AA range: 40-120

COX5a Polyclonal Antibody

ABP57030-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human COX5a at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of COX5a from Human, Mouse, Rat. This COX5a antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COX5a at AA range: 40-120

COX5a Polyclonal Antibody

ABP57030-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human COX5a at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of COX5a from Human, Mouse, Rat. This COX5a antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COX5a at AA range: 40-120

COX5A Polyclonal Antibody

A52616 100 µg
EUR 570.55
Description: kits suitable for this type of research

COX5A Rabbit pAb

A6437-100ul 100 ul
EUR 308

COX5A Rabbit pAb

A6437-200ul 200 ul
EUR 459

COX5A Rabbit pAb

A6437-20ul 20 ul
EUR 183

COX5A Rabbit pAb

A6437-50ul 50 ul
EUR 223

Polyclonal COX5A Antibody (Center)

APG02718G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human COX5A (Center). This antibody is tested and proven to work in the following applications:

COX5A antibody

70R-50706 100 ul
EUR 244
Description: Purified Polyclonal COX5A antibody

COX5A antibody

70R-32393 100 ug
EUR 327
Description: Rabbit polyclonal COX5A antibody

COX5A Antibody

ABD3561 100 ug
EUR 438

COX5A antibody

38915-100ul 100ul
EUR 252

COX5A Antibody

34224-100ul 100ul
EUR 252

COX5A Antibody

34224-50ul 50ul
EUR 187

COX5A antibody

70R-15171 100 ug
EUR 327
Description: Rabbit polyclonal COX5A antibody

COX5A antibody

70R-16536 50 ul
EUR 435
Description: Rabbit polyclonal COX5A antibody

COX5A Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against COX5A. Recognizes COX5A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

COX5A Antibody

CSB-PA989353-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against COX5A. Recognizes COX5A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

COX5A Antibody

DF3561 200ul
EUR 304
Description: COX5A Antibody detects endogenous levels of total COX5A.

COX5A Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against COX5A. Recognizes COX5A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

COX5A Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COX5A. Recognizes COX5A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

COX5A Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against COX5A. Recognizes COX5A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

COX5A Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against COX5A. Recognizes COX5A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

COX5A Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against COX5A. Recognizes COX5A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

Polyclonal COX5A Antibody (N-term)

APG02719G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human COX5A (N-term). This antibody is tested and proven to work in the following applications:

COX5A Polyclonal Antibody, Biotin Conjugated

A52613 100 µg
EUR 570.55
Description: The best epigenetics products

COX5A Polyclonal Antibody, FITC Conjugated

A52614 100 µg
EUR 570.55
Description: kits suitable for this type of research

COX5A Polyclonal Antibody, HRP Conjugated

A52615 100 µg
EUR 570.55
Description: fast delivery possible

COX5A Conjugated Antibody

C34224 100ul
EUR 397

anti- COX5A antibody

FNab01900 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • IF: 1:10 - 1:100
  • Immunogen: cytochrome c oxidase subunit Va
  • Uniprot ID: P20674
  • Gene ID: 9377
  • Research Area: Metabolism
Description: Antibody raised against COX5A

Anti-COX5A Antibody

A07895 100ul
EUR 397
Description: Rabbit Polyclonal COX5A Antibody. Validated in WB and tested in Human, Mouse, Rat.

Human COX5A Antibody

33354-05111 150 ug
EUR 261

COX5A antibody (HRP)

60R-1350 100 ug
EUR 327
Description: Rabbit polyclonal COX5A antibody (HRP)

COX5A antibody (FITC)

60R-1351 100 ug
EUR 327
Description: Rabbit polyclonal COX5A antibody (FITC)

COX5A antibody (biotin)

60R-1352 100 ug
EUR 327
Description: Rabbit polyclonal COX5A antibody (biotin)

Anti-COX5A antibody

PAab01900 100 ug
EUR 355

Anti-COX5a antibody

STJ92441 200 µl
EUR 197
Description: Rabbit polyclonal to COX5a.

Anti-COX5A antibody

STJ28520 100 µl
EUR 277
Description: Cytochrome c oxidase (COX) is the terminal enzyme of the mitochondrial respiratory chain. It is a multi-subunit enzyme complex that couples the transfer of electrons from cytochrome c to molecular oxygen and contributes to a proton electrochemical gradient across the inner mitochondrial membrane. The complex consists of 13 mitochondrial- and nuclear-encoded subunits. The mitochondrially-encoded subunits perform the electron transfer of proton pumping activities. The functions of the nuclear-encoded subunits are unknown but they may play a role in the regulation and assembly of the complex. This gene encodes the nuclear-encoded subunit Va of the human mitochondrial respiratory chain enzyme. A pseudogene COX5AP1 has been found in chromosome 14q22.

Cox5a/ Rat Cox5a ELISA Kit

ELI-03244r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA16256 100 ug
EUR 403
Description: Rabbit polyclonal to COX5A

COX5A Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COX5A. Recognizes COX5A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

COX5A Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COX5A. Recognizes COX5A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

COX5A Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COX5A. Recognizes COX5A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

COX5A cloning plasmid

CSB-CL005836HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 453
  • Sequence: atgctgggcgccgctctccgccgctgcgctgtggccgcaaccacccgggccgaccctcgaggcctcctgcactccgcccggacccccggccccgccgtggctatccagtcagttcgctgctattcccatgggtcacaggagacagatgaggagtttgatgctcgctgggtaacata
  • Show more
Description: A cloning plasmid for the COX5A gene.

COX5A Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

COX5A Blocking Peptide

DF3561-BP 1mg
EUR 195

Anti-COX5A (1G10)

YF-MA16811 100 ug
EUR 363
Description: Mouse monoclonal to COX5A

Human COX5A Antibody (Biotin Conjugate)

33354-05121 150 ug
EUR 369

[One Step] COX5A Antibody Kit

RK05636 50 ul
EUR 240

Human COX5A AssayLite Antibody (FITC Conjugate)

33354-05141 150 ug
EUR 428

COX5a Rabbit Polyclonal Antibody