TLK1 Rabbit Polyclonal Antibody

TLK1 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

TLK1 Polyclonal Antibody

ES8116-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TLK1 from Human/Mouse. This antibody is tested and validated for IF, WB, ELISA

TLK1 Polyclonal Antibody

ES3616-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TLK1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

TLK1 Polyclonal Antibody

ES3616-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TLK1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

TLK1 Polyclonal Antibody

ABP52617-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human TLK1 at AA range: 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of TLK1 from Human. This TLK1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TLK1 at AA range: 180-260

TLK1 Polyclonal Antibody

ABP52617-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human TLK1 at AA range: 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of TLK1 from Human. This TLK1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TLK1 at AA range: 180-260

TLK1 Polyclonal Antibody

ABP52617-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human TLK1 at AA range: 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of TLK1 from Human. This TLK1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TLK1 at AA range: 180-260

TLK1 Polyclonal Antibody

ABP57117-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human TLK1 around the non-phosphorylation site of S764
  • Applications tips:
Description: A polyclonal antibody for detection of TLK1 from Human, Mouse. This TLK1 antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TLK1 around the non-phosphorylation site of S764

TLK1 Polyclonal Antibody

ABP57117-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human TLK1 around the non-phosphorylation site of S764
  • Applications tips:
Description: A polyclonal antibody for detection of TLK1 from Human, Mouse. This TLK1 antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TLK1 around the non-phosphorylation site of S764

TLK1 Polyclonal Antibody

ABP57117-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human TLK1 around the non-phosphorylation site of S764
  • Applications tips:
Description: A polyclonal antibody for detection of TLK1 from Human, Mouse. This TLK1 antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TLK1 around the non-phosphorylation site of S764

TLK1 Rabbit pAb

A14831-100ul 100 ul
EUR 308

TLK1 Rabbit pAb

A14831-200ul 200 ul
EUR 459

TLK1 Rabbit pAb

A14831-20ul 20 ul
EUR 183

TLK1 Rabbit pAb

A14831-50ul 50 ul
EUR 223

TLK1 Rabbit pAb

A8913-100ul 100 ul
EUR 308

TLK1 Rabbit pAb

A8913-200ul 200 ul
EUR 459

TLK1 Rabbit pAb

A8913-20ul 20 ul Ask for price

TLK1 Rabbit pAb

A8913-50ul 50 ul Ask for price

TLK1 Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

TLK1 antibody

70R-50750 100 ul
EUR 244
Description: Purified Polyclonal TLK1 antibody

TLK1 antibody

70R-50751 100 ul
EUR 244
Description: Purified Polyclonal TLK1 antibody

TLK1 antibody

70R-51356 100 ul
EUR 287
Description: Purified Polyclonal TLK1 antibody

TLK1 antibody

70R-5667 50 ug
EUR 467
Description: Rabbit polyclonal TLK1 antibody raised against the N terminal of TLK1

TLK1 antibody

70R-2084 50 ug
EUR 467
Description: Rabbit polyclonal TLK1 antibody raised against the middle region of TLK1

TLK1 antibody

70R-20846 50 ul
EUR 435
Description: Rabbit polyclonal TLK1 antibody

TLK1 antibody

70R-31541 100 ug
EUR 327
Description: Rabbit polyclonal TLK1 antibody

TLK1 Antibody

ABD4792 100 ug
EUR 438

TLK1 Antibody

35297-100ul 100ul
EUR 252

TLK1 Antibody

35297-50ul 50ul
EUR 187

TLK1 Antibody

DF4792 200ul
EUR 304
Description: TLK1 Antibody detects endogenous levels of total TLK1.

TLK1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TLK1. Recognizes TLK1 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

TLK1 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TLK1. Recognizes TLK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TLK1 Antibody

CSB-PA178566-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TLK1. Recognizes TLK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TLK1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TLK1. Recognizes TLK1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/5000

TLK1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TLK1. Recognizes TLK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal TLK1 Antibody (aa730-779)

AMM08221G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLK1 (aa730-779). This antibody is tested and proven to work in the following applications:

Polyclonal TLK1 Antibody (C-term)

APR14414G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLK1 (C-term). This antibody is tested and proven to work in the following applications:

TLK1 (Phospho-Ser764) Polyclonal Conjugated Antibody

C12419 100ul
EUR 397

TLK1 Conjugated Antibody

C35297 100ul
EUR 397

anti- TLK1 antibody

FNab08724 100µg
EUR 548.75
  • Immunogen: tousled-like kinase 1
  • Uniprot ID: Q9UKI8
  • Gene ID: 9874
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against TLK1

TLK1 (pS743) Antibody

  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Mouse Tlk1 Antibody

abx029447-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mouse Tlk1 Antibody

abx029447-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

TLK1 (pS764) Antibody

abx219001-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Anti-TLK1 Antibody

A05635-1 100ul
EUR 397
Description: Rabbit Polyclonal TLK1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TLK1 antibody

PAab08724 100 ug
EUR 386

Anti-TLK1 antibody

STJ96037 200 µl
EUR 197
Description: Rabbit polyclonal to TLK1.

Anti-TLK1 antibody

STJ96038 200 µl
EUR 197
Description: Rabbit polyclonal to TLK1.

Anti-TLK1 antibody

STJ111477 100 µl
EUR 277
Description: The protein encoded by this gene is a serine/threonine kinase that may be involved in the regulation of chromatin assembly. The encoded protein is only active when it is phosphorylated, and this phosphorylation is cell cycle-dependent, with the maximal activity of this protein coming during S phase. The catalytic activity of this protein is diminished by DNA damage and by blockage of DNA replication. Three transcript variants encoding different isoforms have been found for this gene.

Anti-TLK1 antibody

STJ117031 100 µl
EUR 277
Description: The protein encoded by this gene is a serine/threonine kinase that may be involved in the regulation of chromatin assembly. The encoded protein is only active when it is phosphorylated, and this phosphorylation is cell cycle-dependent, with the maximal activity of this protein coming during S phase. The catalytic activity of this protein is diminished by DNA damage and by blockage of DNA replication. Three transcript variants encoding different isoforms have been found for this gene.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA27462 50 ug
EUR 363
Description: Mouse polyclonal to TLK1

Phospho-TLK1 (Ser743) Antibody

AF2425 200ul
EUR 304
Description: Phospho-TLK1 (Ser743) Antibody detects endogenous levels of TLK1.

Phospho-TLK1 (Ser764) Antibody

AF8029 200ul
EUR 376
Description: TLK1 (Phospho-Ser764) Antibody detects endogenous levels of TLK1 only when phosphorylated at Ser764.

Phospho- TLK1 (Ser743) Antibody

ABF3780 100 ug
EUR 438

TLK1 (Phospho- Ser764) Antibody

ABF8029 100 ug
EUR 438

TLK1 (Phospho-Ser764) Antibody

12419-100ul 100ul
EUR 252

TLK1 (Phospho-Ser764) Antibody

12419-50ul 50ul
EUR 187

TLK1 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

TLK1 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

TLK1 Blocking Peptide

33R-2724 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TLK1 antibody, catalog no. 70R-5667

TLK1 Blocking Peptide

33R-8120 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TLK1 antibody, catalog no. 70R-2084

TLK1 Blocking Peptide

DF4792-BP 1mg
EUR 195

TLK1 cloning plasmid

CSB-CL891950HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2301
  • Sequence: atgagtgtccaaagtagcagtggaagtttggaggggccgccatcttggtcccagctctccacgtctccaaccccgggctcggcggcggcggccaggtccctgctgaatcacacgccgccatccgggaggcccagggaaggtgcaatggatgagcttcatagtctggatccaagaa
  • Show more
Description: A cloning plasmid for the TLK1 gene.

Anti-TLK1 (4B3)

YF-MA11218 100 ug
EUR 363
Description: Mouse monoclonal to TLK1


EF003631 96 Tests
EUR 689


ELI-52132h 96 Tests
EUR 824

Mouse Tlk1 ELISA KIT

ELI-40041m 96 Tests
EUR 865

TLK1 (pS743) Blocking Peptide

  • EUR 314.00
  • EUR 509.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Human TLK1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TLK1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Tousled-Like Kinase 1 (TLK1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phospho-TLK1 (Ser743) Blocking Peptide

AF2425-BP 1mg
EUR 195

Phospho-TLK1 (Ser764) Blocking Peptide

AF8029-BP 1mg
EUR 195

Tlk1 ORF Vector (Mouse) (pORF)

ORF059644 1.0 ug DNA
EUR 506

TLK1 ORF Vector (Human) (pORF)

ORF010560 1.0 ug DNA
EUR 95

Tlk1 ORF Vector (Rat) (pORF)

ORF077747 1.0 ug DNA
EUR 506

TLK1 sgRNA CRISPR Lentivector set (Human)

K2378801 3 x 1.0 ug
EUR 339

Tlk1 sgRNA CRISPR Lentivector set (Rat)

K6387101 3 x 1.0 ug
EUR 339

Tlk1 sgRNA CRISPR Lentivector set (Mouse)

K4996601 3 x 1.0 ug
EUR 339

Serine/threonine-Protein Kinase Tousled-Like 1 (TLK1) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase Tousled-Like 1 (TLK1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase Tousled-Like 1 (TLK1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Serine/Threonine-Protein Kinase Tousled-Like 1 (TLK1) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Serine/Threonine-Protein Kinase Tousled-Like 1 (TLK1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine/Threonine-Protein Kinase Tousled-Like 1 (TLK1) Antibody

abx331211-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase Tousled-Like 1 (TLK1) Antibody

abx238724-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

TLK1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2378802 1.0 ug DNA
EUR 154

TLK1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2378803 1.0 ug DNA
EUR 154

TLK1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2378804 1.0 ug DNA
EUR 154

Tlk1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6387102 1.0 ug DNA
EUR 154

Tlk1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6387103 1.0 ug DNA
EUR 154

Tlk1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6387104 1.0 ug DNA
EUR 154

Tlk1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4996602 1.0 ug DNA
EUR 154

Tlk1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4996603 1.0 ug DNA
EUR 154

Tlk1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4996604 1.0 ug DNA
EUR 154

TLK1 Protein Vector (Human) (pPB-C-His)

PV042237 500 ng
EUR 329

TLK1 Protein Vector (Human) (pPB-N-His)

PV042238 500 ng
EUR 329

TLK1 Protein Vector (Human) (pPM-C-HA)

PV042239 500 ng
EUR 329

TLK1 Protein Vector (Human) (pPM-C-His)

PV042240 500 ng
EUR 329

TLK1 Protein Vector (Rat) (pPB-C-His)

PV310986 500 ng
EUR 603

TLK1 Protein Vector (Rat) (pPB-N-His)

PV310987 500 ng
EUR 603

TLK1 Protein Vector (Rat) (pPM-C-HA)

PV310988 500 ng
EUR 603

TLK1 Protein Vector (Rat) (pPM-C-His)

PV310989 500 ng
EUR 603

TLK1 Protein Vector (Mouse) (pPB-C-His)

PV238574 500 ng
EUR 1065

TLK1 Protein Vector (Mouse) (pPB-N-His)

PV238575 500 ng
EUR 1065

TLK1 Protein Vector (Mouse) (pPM-C-HA)

PV238576 500 ng
EUR 1065

TLK1 Protein Vector (Mouse) (pPM-C-His)

PV238577 500 ng
EUR 1065

Tlk1 3'UTR GFP Stable Cell Line

TU170536 1.0 ml Ask for price

TLK1 3'UTR GFP Stable Cell Line

TU075630 1.0 ml
EUR 2333

Tlk1 3'UTR Luciferase Stable Cell Line

TU120536 1.0 ml Ask for price

TLK1 3'UTR Luciferase Stable Cell Line

TU025630 1.0 ml
EUR 2333

Tlk1 3'UTR Luciferase Stable Cell Line

TU221929 1.0 ml Ask for price

Tlk1 3'UTR GFP Stable Cell Line

TU271929 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

TLK1 Rabbit Polyclonal Antibody