TLR6 Rabbit Polyclonal Antibody

TLR6 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

Polyclonal TLR6 Antibody
AMM05419G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR6 . This antibody is tested and proven to work in the following applications:

Polyclonal TLR6 Antibody
AMM05420G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR6 . This antibody is tested and proven to work in the following applications:

TLR6 Polyclonal Antibody
A61326 100 µg
EUR 570.55
Description: fast delivery possible

TLR6 Polyclonal Antibody
ABP57215-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR6 from Human, Mouse, Rat. This TLR6 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR6 Polyclonal Antibody
ABP57215-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR6 from Human, Mouse, Rat. This TLR6 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR6 Polyclonal Antibody
ABP57215-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR6 from Human, Mouse, Rat. This TLR6 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR6 Polyclonal Antibody
ES8214-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TLR6 from Human/Mouse/Rat. This antibody is tested and validated for IHC

TLR6 Polyclonal Antibody
ES8214-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TLR6 from Human/Mouse/Rat. This antibody is tested and validated for IHC

Polyclonal TLR6 Antibody (Internal)
AMM05421G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR6 (Internal). This antibody is tested and proven to work in the following applications:

Human Toll Like Receptor 6 (TLR6) ELISA Kit
DLR-TLR6-Hu-48T 48T
EUR 479
  • Should the Human Toll Like Receptor 6 (TLR6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Toll Like Receptor 6 (TLR6) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Toll Like Receptor 6 (TLR6) ELISA Kit
DLR-TLR6-Hu-96T 96T
EUR 621
  • Should the Human Toll Like Receptor 6 (TLR6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Toll Like Receptor 6 (TLR6) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Toll Like Receptor 6 (TLR6) ELISA Kit
DLR-TLR6-Mu-48T 48T
EUR 489
  • Should the Mouse Toll Like Receptor 6 (TLR6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Toll Like Receptor 6 (TLR6) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Toll Like Receptor 6 (TLR6) ELISA Kit
DLR-TLR6-Mu-96T 96T
EUR 635
  • Should the Mouse Toll Like Receptor 6 (TLR6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Toll Like Receptor 6 (TLR6) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Toll Like Receptor 6 (TLR6) ELISA Kit
RDR-TLR6-Hu-48Tests 48 Tests
EUR 500

Human Toll Like Receptor 6 (TLR6) ELISA Kit
RDR-TLR6-Hu-96Tests 96 Tests
EUR 692

Mouse Toll Like Receptor 6 (TLR6) ELISA Kit
RDR-TLR6-Mu-48Tests 48 Tests
EUR 511

Mouse Toll Like Receptor 6 (TLR6) ELISA Kit
RDR-TLR6-Mu-96Tests 96 Tests
EUR 709

Human Toll Like Receptor 6 (TLR6) ELISA Kit
RD-TLR6-Hu-48Tests 48 Tests
EUR 478

Human Toll Like Receptor 6 (TLR6) ELISA Kit
RD-TLR6-Hu-96Tests 96 Tests
EUR 662

Mouse Toll Like Receptor 6 (TLR6) ELISA Kit
RD-TLR6-Mu-48Tests 48 Tests
EUR 489

Mouse Toll Like Receptor 6 (TLR6) ELISA Kit
RD-TLR6-Mu-96Tests 96 Tests
EUR 677

TLR6 Antibody
24367-100ul 100ul
EUR 390

TLR6 Antibody
24368-100ul 100ul
EUR 390

TLR6 antibody
70R-2269 50 ug
EUR 467
Description: Rabbit polyclonal TLR6 antibody raised against the middle region of TLR6

TLR6 Antibody
36166-100ul 100ul
EUR 252

TLR6 Antibody
1-CSB-PA080186
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TLR6. Recognizes TLR6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1:200-500.ELISA:1/10000

TLR6 Antibody
1-CSB-PA086865
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR6. Recognizes TLR6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

TLR6 Antibody
1-CSB-PA295852
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR6. Recognizes TLR6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

TLR6 Antibody
1-CSB-PA226880
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR6. Recognizes TLR6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

TLR6 Antibody
1-CSB-PA023605LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR6. Recognizes TLR6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

TLR6 Polyclonal Antibody, Biotin Conjugated
A61327 100 µg
EUR 570.55
Description: reagents widely cited

TLR6 Polyclonal Antibody, FITC Conjugated
A61328 100 µg
EUR 570.55
Description: Ask the seller for details

TLR6 Polyclonal Antibody, HRP Conjugated
A61329 100 µg
EUR 570.55
Description: The best epigenetics products

TLR6 Conjugated Antibody
C36166 100ul
EUR 397

anti- TLR6 antibody
FNab08729 100µg
EUR 548.75
  • Immunogen: toll-like receptor 6
  • Uniprot ID: Q9Y2C9
  • Gene ID: 10333
  • Research Area: Immunology, Signal Transduction, Developmental biology
Description: Antibody raised against TLR6

Anti-TLR6 antibody
PAab08729 100 ug
EUR 386

Anti-TLR6 antibody
STJ97409 200 µl
EUR 197
Description: Rabbit polyclonal to TLR6.

Anti-TLR6 Antibody
STJ503280 100 µg
EUR 476

TLR6 siRNA
20-abx936899
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TLR6 siRNA
20-abx936900
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TLR6/CD286
RA30053 50 ug
EUR 618

anti-TLR6
YF-PA25551 50 ul
EUR 334
Description: Mouse polyclonal to TLR6

TLR6 Antibody, HRP conjugated
1-CSB-PA023605LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR6. Recognizes TLR6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TLR6 Antibody, FITC conjugated
1-CSB-PA023605LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR6. Recognizes TLR6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TLR6 Antibody, Biotin conjugated
1-CSB-PA023605LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR6. Recognizes TLR6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-TLR6 Antibody (Biotin)
STJ503303 100 µg
EUR 586

Anti-TLR6 Antibody (FITC)
STJ503304 100 µg
EUR 586

Toll Like Receptor 6 (TLR6) Polyclonal Antibody (Human)
4-PAA683Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR6 (Tyr608~Ser796)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 6 (TLR6)

Toll Like Receptor 6 (TLR6) Polyclonal Antibody (Mouse)
4-PAA683Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR6 (Ala17-Met239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 6 (TLR6)

TLR6 Blocking Peptide
33R-4273 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TLR6 antibody, catalog no. 70R-2269

TLR6 cloning plasmid
CSB-CL023605HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1443
  • Sequence: ATGACCAAAGACAAAGAACCTATTGTTAAAAGCTTCCATTTTGTTTGCCTTATGATCATAATAGTTGGAACCAGAATCCAGTTCTCCGACGGAAATGAATTTGCAGTAGACAAGTCAAAAAGAGGTCTTATTCATGTTCCAAAAGACCTACCGCTGAAAACCAAAGTCTTAGATA
  • Show more
Description: A cloning plasmid for the TLR6 gene.

Anti-TLR6 (4E4)
YF-MA17254 100 ug
EUR 363
Description: Mouse monoclonal to TLR6

Anti-TLR6 (2B3)
YF-MA17255 100 ug
EUR 363
Description: Mouse monoclonal to TLR6

Anti-TLR6 (1C12)
YF-MA17256 100 ug
EUR 363
Description: Mouse monoclonal to TLR6

Anti-TLR6 (1H4)
YF-MA17257 100 ug
EUR 363
Description: Mouse monoclonal to TLR6

Anti-TLR6 (2B10)
YF-MA17258 100 ug
EUR 363
Description: Mouse monoclonal to TLR6

Anti-TLR6 (1A5)
YF-MA17259 100 ug
EUR 363
Description: Mouse monoclonal to TLR6

Anti-TLR6 (4H3)
YF-MA17260 100 ug
EUR 363
Description: Mouse monoclonal to TLR6

Anti-TLR6 (3D11)
YF-MA17261 100 ug
EUR 363
Description: Mouse monoclonal to TLR6

Anti-TLR6 (3D1)
YF-MA17262 100 ug
EUR 363
Description: Mouse monoclonal to TLR6

Anti-TLR6 (4F4)
YF-MA17263 100 ug
EUR 363
Description: Mouse monoclonal to TLR6

Anti-TLR6 (2F12)
YF-MA17264 100 ug
EUR 363
Description: Mouse monoclonal to TLR6

Anti-TLR6 (1E5)
YF-MA17265 100 ug
EUR 363
Description: Mouse monoclonal to TLR6

Toll Like Receptor 6 (TLR6) Polyclonal Antibody (Human), APC
4-PAA683Hu01-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR6 (Tyr608~Ser796)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 6 (TLR6). This antibody is labeled with APC.

Toll Like Receptor 6 (TLR6) Polyclonal Antibody (Human), Biotinylated
4-PAA683Hu01-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR6 (Tyr608~Ser796)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 6 (TLR6). This antibody is labeled with Biotin.

Toll Like Receptor 6 (TLR6) Polyclonal Antibody (Human), Cy3
4-PAA683Hu01-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR6 (Tyr608~Ser796)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 6 (TLR6). This antibody is labeled with Cy3.

Toll Like Receptor 6 (TLR6) Polyclonal Antibody (Human), FITC
4-PAA683Hu01-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR6 (Tyr608~Ser796)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 6 (TLR6). This antibody is labeled with FITC.

TLR6 Rabbit Polyclonal Antibody