IGFN1 Rabbit Polyclonal Antibody

IGFN1 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

IGFN1 Polyclonal Antibody
ABP57224-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of IGFN1 from Human, Mouse, Rat. This IGFN1 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

IGFN1 Polyclonal Antibody
ES8223-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IGFN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IGFN1 Polyclonal Antibody
ES8223-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IGFN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IGFN1 Antibody
1-CSB-PA080195
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against IGFN1. Recognizes IGFN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:2000-5000.IHC:1:200-500

IGFN1 Antibody
1-CSB-PA080268
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against IGFN1. Recognizes IGFN1 from Human, Mouse, Rat, Pg. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:500-1:2000.IHC:1:50-1:200

Anti-IGFN1 antibody
STJ97418 200 µl
EUR 197
Description: Rabbit polyclonal to IGFN1.

IGFN1 siRNA
20-abx920330
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IGFN1 siRNA
20-abx920331
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IGFN1 cloning plasmid
CSB-CL769786HU-10ug 10ug
EUR 839
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2607
  • Sequence: ATGGGGTGGCAGCCTATGGGAGAGAACTGGGGGTGCCTGGAGGAGATGCTGAATGAAGATCAGAGCCGGGAGCCCCCTGGTCACCTTGGTAGCAGGAGAAGTGGCAAAGACGGCAGGTTGGACATCTATGGAGAGAGGAGAGATGCTACCCGGAGTTCCACATCCAGATACAAGC
  • Show more
Description: A cloning plasmid for the IGFN1 gene.

Mouse Igfn1 ELISA KIT
ELI-13407m 96 Tests
EUR 865

Human IGFN1 ELISA KIT
ELI-08308h 96 Tests
EUR 824

IGFN1 ELISA KIT|Human
EF005124 96 Tests
EUR 689

Human IGFN1 shRNA Plasmid
20-abx964016
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse IGFN1 shRNA Plasmid
20-abx981490
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

IGFN1 ORF Vector (Human) (pORF)
ORF021411 1.0 ug DNA
EUR 405

Igfn1 ORF Vector (Mouse) (pORF)
ORF047747 1.0 ug DNA
EUR 3087

Igfn1 sgRNA CRISPR Lentivector set (Mouse)
K4234401 3 x 1.0 ug
EUR 339

IGFN1 sgRNA CRISPR Lentivector set (Human)
K1026701 3 x 1.0 ug
EUR 339

Igfn1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4234402 1.0 ug DNA
EUR 154

Igfn1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4234403 1.0 ug DNA
EUR 154

Igfn1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4234404 1.0 ug DNA
EUR 154

IGFN1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1026702 1.0 ug DNA
EUR 154

IGFN1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1026703 1.0 ug DNA
EUR 154

IGFN1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1026704 1.0 ug DNA
EUR 154

IGFN1 Protein Vector (Human) (pPB-C-His)
PV085641 500 ng
EUR 811

IGFN1 Protein Vector (Human) (pPB-N-His)
PV085642 500 ng
EUR 811

IGFN1 Protein Vector (Human) (pPM-C-HA)
PV085643 500 ng
EUR 811

IGFN1 Protein Vector (Human) (pPM-C-His)
PV085644 500 ng
EUR 811

IGFN1 Protein Vector (Mouse) (pPB-C-His)
PV190986 500 ng
EUR 4592

IGFN1 Protein Vector (Mouse) (pPB-N-His)
PV190987 500 ng
EUR 4592

IGFN1 Protein Vector (Mouse) (pPM-C-HA)
PV190988 500 ng
EUR 4592

IGFN1 Protein Vector (Mouse) (pPM-C-His)
PV190989 500 ng
EUR 4592

Igfn1 3'UTR Luciferase Stable Cell Line
TU109974 1.0 ml Ask for price

Igfn1 3'UTR GFP Stable Cell Line
TU159974 1.0 ml Ask for price

IGFN1 3'UTR GFP Stable Cell Line
TU060544 1.0 ml
EUR 1521

IGFN1 3'UTR Luciferase Stable Cell Line
TU010544 1.0 ml
EUR 1521

IGFN1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV798693 1.0 ug DNA
EUR 456

IGFN1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV798697 1.0 ug DNA
EUR 456

IGFN1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV798698 1.0 ug DNA
EUR 456

Immunoglobulin Like And Fibronectin Type III Domain Containing 1 (IGFN1) Antibody
20-abx134088
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Immunoglobulin Like and Fibronectin Type III Domain Containing 1 (IGFN1) Antibody
20-abx330105
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Immunoglobulin Like and Fibronectin Type III Domain Containing 1 (IGFN1) Antibody
20-abx326992
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Igfn1 ELISA Kit| Mouse Immunoglobulin-like and fibronectin type
EF015232 96 Tests
EUR 689

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

IGFN1 Rabbit Polyclonal Antibody