TMPO Rabbit Polyclonal Antibody

TMPO Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

TMPO Polyclonal Antibody

ABP57555-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic peptide from human protein at AA range: 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of TMPO from Human, Mouse, Rat. This TMPO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1-50

TMPO Polyclonal Antibody

ABP57555-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of TMPO from Human, Mouse, Rat. This TMPO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1-50

TMPO Polyclonal Antibody

ABP57555-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of TMPO from Human, Mouse, Rat. This TMPO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1-50

TMPO Polyclonal Antibody

ES8548-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TMPO from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

TMPO Polyclonal Antibody

ES8548-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TMPO from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

TMPO/TMPO Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against TMPO/TMPO. Recognizes TMPO/TMPO from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000

TMPO / TMPO Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

TMPO antibody

70R-20884 50 ul
EUR 435
Description: Rabbit polyclonal TMPO antibody

TMPO Antibody

32699-100ul 100ul
EUR 252

TMPO Antibody

DF6994 200ul
EUR 304
Description: TMPO Antibody detects endogenous levels of total TMPO.

TMPO Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TMPO. Recognizes TMPO from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

TMPO Antibody

ABD6994 100 ug
EUR 438

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO)

[KO Validated] TMPO Rabbit pAb

A2534-100ul 100 ul
EUR 410

[KO Validated] TMPO Rabbit pAb

A2534-200ul 200 ul
EUR 571

[KO Validated] TMPO Rabbit pAb

A2534-20ul 20 ul
EUR 221

[KO Validated] TMPO Rabbit pAb

A2534-50ul 50 ul
EUR 287

Thymopoietin (TMPO) Antibody

abx028266-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody

abx028266-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Thymopoietin (TMPO) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Thymopoietin (TMPO) Antibody

abx030767-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody

abx030767-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

TMPO Conjugated Antibody

C32699 100ul
EUR 397

Thymopoietin (TMPO) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-TMPO antibody

STJ25881 100 µl
EUR 413
Description: The protein encoded by this gene resides in the nucleus and may play a role in the assembly of the nuclear lamina, and thus help maintain the structural organization of the nuclear envelope. It may function as a receptor for the attachment of lamin filaments to the inner nuclear membrane. Mutations in this gene are associated with dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.

Anti-TMPO antibody

STJ98661 200 µl
EUR 197
Description: TMPO is a protein encoded by the TMPO gene which is approximately 75,4 kDa. TMPO is localised to the nucleus and is involved in the mitotic cell cycle, nuclear envelope reassembly, transport of the SLBP independent mature mRNA and apoptosis. It may be involved in the structural organization of the nucleus and in the post-mitotic nuclear assembly and plays an important role, together with LMNA, in the nuclear anchorage of RB1. It may also be involved in the control of initiation of DNA replication through its interaction with NAKAP95. TMPO is expressed in many tissues and is most abundant in adult thymus and fetal liver. Mutations in the TMPO gene result in dilated cardiomyopathy and dysentery. STJ98661 was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen. This antibody detects endogenous TMPO protein.

Polyclonal TMPO / TP / Thymopoietin Antibody (N-Terminus)

APR03096G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMPO / TP / Thymopoietin (N-Terminus). This antibody is tested and proven to work in the following applications:

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with APC.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with Biotin.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with Cy3.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with FITC.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with HRP.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with PE.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA27383 50 ug
EUR 363
Description: Mouse polyclonal to TMPO

Anti-TMPO/Lap2 Antibody

A03278 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for TMPO Antibody (TMPO) detection.tested for IHC, WB in Human, Mouse, Rat.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with APC-Cy7.

TMPO Blocking Peptide

DF6994-BP 1mg
EUR 195

TMPO cloning plasmid

CSB-CL023913HU-10ug 10ug
EUR 492
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1365
  • Sequence: atgccggagttcctggaagacccctcggtcctgacaaaagacaagttgaagagtgagttggtcgccaacaatgtgacgctgccggccggggagcagcgcaaagacgtgtacgtccagctctacctgcagcacctcacggctcgcaaccggccgccgctccccgccggcaccaaca
  • Show more
Description: A cloning plasmid for the TMPO gene.

Recombinant Thymopoietin (TMPO)

  • EUR 445.86
  • EUR 222.00
  • EUR 1396.96
  • EUR 532.32
  • EUR 964.64
  • EUR 361.00
  • EUR 3342.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P42167
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Thymopoietin expressed in: E.coli

Mouse Tmpo ELISA KIT

ELI-04131m 96 Tests
EUR 865


ELI-04132h 96 Tests
EUR 824

Mouse Tmpo ELISA KIT

ELI-04134m 96 Tests
EUR 865

Mouse TMPO shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TMPO shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat TMPO shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Thymopoietin (TMPO) Protein

  • EUR 620.00
  • EUR 272.00
  • EUR 1887.00
  • EUR 746.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human TMPO shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TMPO shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TMPO Recombinant Protein (Rat)

RP233936 100 ug Ask for price

TMPO Rabbit Polyclonal Antibody