SLC12A4 Rabbit Polyclonal Antibody

SLC12A4 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

SLC12A4 Polyclonal Antibody

A68126 100 µg
EUR 570.55
Description: Ask the seller for details

SLC12A4 Polyclonal Antibody

ABP57339-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of SLC12A4 from Human, Mouse, Rat. This SLC12A4 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

SLC12A4 Polyclonal Antibody

ABP57339-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of SLC12A4 from Human, Mouse, Rat. This SLC12A4 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

SLC12A4 Polyclonal Antibody

ABP57339-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of SLC12A4 from Human, Mouse, Rat. This SLC12A4 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

SLC12A4 Polyclonal Antibody

ES8332-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SLC12A4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

SLC12A4 Polyclonal Antibody

ES8332-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SLC12A4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

SLC12A4 antibody

70R-20299 50 ul
EUR 435
Description: Rabbit polyclonal SLC12A4 antibody

SLC12A4 Antibody

35916-100ul 100ul
EUR 252

SLC12A4 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC12A4. Recognizes SLC12A4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SLC12A4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SLC12A4. Recognizes SLC12A4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

SLC12A4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SLC12A4. Recognizes SLC12A4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

SLC12A4 antibody

70R-5705 50 ug
EUR 467
Description: Rabbit polyclonal SLC12A4 antibody

SLC12A4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SLC12A4. Recognizes SLC12A4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal SLC12A4 / KCC1 Antibody (Internal)

APR09976G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SLC12A4 / KCC1 (Internal). This antibody is tested and proven to work in the following applications:

SLC12A4 Polyclonal Antibody, HRP Conjugated

A68127 100 µg
EUR 570.55
Description: The best epigenetics products

SLC12A4 Polyclonal Antibody, FITC Conjugated

A68128 100 µg
EUR 570.55
Description: kits suitable for this type of research

SLC12A4 Polyclonal Antibody, Biotin Conjugated

A68129 100 µg
EUR 570.55
Description: fast delivery possible

Polyclonal Goat Anti-KCC1 / SLC12A4 Antibody

AMM05027G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-KCC1 / SLC12A4 . This antibody is tested and proven to work in the following applications:

Slc12a4/ Rat Slc12a4 ELISA Kit

ELI-42125r 96 Tests
EUR 886

SLC12A4 Conjugated Antibody

C35916 100ul
EUR 397

anti- SLC12A4 antibody

FNab07907 100µg
EUR 548.75
  • Immunogen: solute carrier family 12(potassium/chloride transporters), member 4
  • Uniprot ID: Q9UP95
  • Gene ID: 6560
  • Research Area: Signal Transduction
Description: Antibody raised against SLC12A4

Anti-SLC12A4 antibody

PAab07907 100 ug
EUR 386

Anti-SLC12A4 antibody

STJ97586 200 µl
EUR 197
Description: Rabbit polyclonal to SLC12A4 (A248).


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SLC12A4 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC12A4. Recognizes SLC12A4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SLC12A4 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC12A4. Recognizes SLC12A4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SLC12A4 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC12A4. Recognizes SLC12A4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-SLC12A4/Kcc1 Antibody

A02864 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for SLC12A4 Antibody (SLC12A4) detection. Tested with WB, IHC in Human, Rat, Mouse.

Anti-KCC1 / SLC12A4 antibody

STJ71332 100 µg
EUR 359

SLC12A4 Blocking Peptide

33R-6285 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLC12A4 antibody, catalog no. 70R-5705

SLC12A4 cloning plasmid

CSB-CL892363HU-10ug 10ug
EUR 1196
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3258
  • Sequence: atgcctcacttcaccgtggtgccagtggacgggccgaggcgcggcgactatgacaacctcgaggggctcagttgggtggactacggggagcgcgccgagctggatgactcggacggacatggcaaccacagagagagcagcccttttctttcccccttggaggcttccagaggaa
  • Show more
Description: A cloning plasmid for the SLC12A4 gene.

Anti-SLC12A4 (1H6)

YF-MA15449 100 ug
EUR 363
Description: Mouse monoclonal to SLC12A4


EF002963 96 Tests
EUR 689

Mouse SLC12A4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SLC12A4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SLC12A4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Slc12a4 ORF Vector (Rat) (pORF)

ORF076302 1.0 ug DNA
EUR 506

SLC12A4 ORF Vector (Human) (pORF)

ORF009562 1.0 ug DNA
EUR 95

Slc12a4 ORF Vector (Mouse) (pORF)

ORF057409 1.0 ug DNA
EUR 506

Slc12a4 ORF Vector (Mouse) (pORF)

ORF057410 1.0 ug DNA
EUR 506

Rabbit Solute carrier family 12 member 4, SLC12A4 ELISA KIT

ELI-13451Ra 96 Tests
EUR 928

Solute Carrier Family 12 Member 4 (SLC12A4) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Solute Carrier Family 12 Member 4 (SLC12A4) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Solute Carrier Family 12 Member 4 (SLC12A4) Antibody

abx237907-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Solute Carrier Family 12 Member 4 (SLC12A4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Solute Carrier Family 12 Member 4 (SLC12A4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Solute Carrier Family 12 Member 4 (SLC12A4) Antibody

abx430102-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Solute Carrier Family 12 Member 4 (SLC12A4) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Slc12a4 sgRNA CRISPR Lentivector set (Rat)

K6795001 3 x 1.0 ug
EUR 339

SLC12A4 sgRNA CRISPR Lentivector set (Human)

K2167201 3 x 1.0 ug
EUR 339

Slc12a4 sgRNA CRISPR Lentivector set (Mouse)

K3265301 3 x 1.0 ug
EUR 339

Solute Carrier Family 12 Member 4 (SLC12A4) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Solute Carrier Family 12 Member 4 (SLC12A4) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Solute Carrier Family 12 Member 4 (SLC12A4) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Slc12a4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6795002 1.0 ug DNA
EUR 154

Slc12a4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6795003 1.0 ug DNA
EUR 154

Slc12a4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6795004 1.0 ug DNA
EUR 154

SLC12A4 sgRNA CRISPR Lentivector (Human) (Target 1)

K2167202 1.0 ug DNA
EUR 154

SLC12A4 sgRNA CRISPR Lentivector (Human) (Target 2)

K2167203 1.0 ug DNA
EUR 154

SLC12A4 sgRNA CRISPR Lentivector (Human) (Target 3)

K2167204 1.0 ug DNA
EUR 154

Slc12a4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3265302 1.0 ug DNA
EUR 154

Slc12a4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3265303 1.0 ug DNA
EUR 154

Slc12a4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3265304 1.0 ug DNA
EUR 154

SLC12A4 Protein Vector (Rat) (pPB-C-His)

PV305206 500 ng
EUR 1166

SLC12A4 Protein Vector (Rat) (pPB-N-His)

PV305207 500 ng
EUR 1166

SLC12A4 Protein Vector (Rat) (pPM-C-HA)

PV305208 500 ng
EUR 1166

SLC12A4 Protein Vector (Rat) (pPM-C-His)

PV305209 500 ng
EUR 1166

SLC12A4 Protein Vector (Human) (pPB-C-His)

PV038245 500 ng
EUR 329

SLC12A4 Protein Vector (Human) (pPB-N-His)

PV038246 500 ng
EUR 329

SLC12A4 Protein Vector (Human) (pPM-C-HA)

PV038247 500 ng
EUR 329

SLC12A4 Protein Vector (Human) (pPM-C-His)

PV038248 500 ng
EUR 329

SLC12A4 Protein Vector (Mouse) (pPB-C-His)

PV229634 500 ng
EUR 1065

SLC12A4 Protein Vector (Mouse) (pPB-N-His)

PV229635 500 ng
EUR 1065

SLC12A4 Protein Vector (Mouse) (pPM-C-HA)

PV229636 500 ng
EUR 1065

SLC12A4 Protein Vector (Mouse) (pPM-C-His)

PV229637 500 ng
EUR 1065

SLC12A4 Protein Vector (Mouse) (pPB-C-His)

PV229638 500 ng
EUR 1065

SLC12A4 Protein Vector (Mouse) (pPB-N-His)

PV229639 500 ng
EUR 1065

SLC12A4 Protein Vector (Mouse) (pPM-C-HA)

PV229640 500 ng
EUR 1065

SLC12A4 Protein Vector (Mouse) (pPM-C-His)

PV229641 500 ng
EUR 1065

Slc12a4 3'UTR Luciferase Stable Cell Line

TU118897 1.0 ml Ask for price

Slc12a4 3'UTR GFP Stable Cell Line

TU168897 1.0 ml Ask for price

Slc12a4 3'UTR Luciferase Stable Cell Line

TU220429 1.0 ml Ask for price

Slc12a4 3'UTR GFP Stable Cell Line

TU270429 1.0 ml Ask for price

SLC12A4 3'UTR GFP Stable Cell Line

TU073387 1.0 ml
EUR 1521

SLC12A4 3'UTR Luciferase Stable Cell Line

TU023387 1.0 ml
EUR 1521

SLC12A4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV690541 1.0 ug DNA
EUR 1355

SLC12A4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV690545 1.0 ug DNA
EUR 1355

SLC12A4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV690546 1.0 ug DNA
EUR 1355

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

SLC12A4 Rabbit Polyclonal Antibody