CACNG3 Rabbit Polyclonal Antibody

CACNG3 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

CACNG3 Polyclonal Antibody
ABP57223-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CACNG3 from Human, Mouse, Rat. This CACNG3 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide
CACNG3 Polyclonal Antibody
ABP57223-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CACNG3 from Human, Mouse, Rat. This CACNG3 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide
CACNG3 Polyclonal Antibody
ES8222-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CACNG3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
CACNG3 Polyclonal Antibody
ES8222-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CACNG3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
CACNG3 antibody
70R-16119 50 ul
EUR 435
Description: Rabbit polyclonal CACNG3 antibody
CACNG3 Antibody
46388-100ul 100ul
EUR 252
CACNG3 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CACNG3. Recognizes CACNG3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
CACNG3 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CACNG3. Recognizes CACNG3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:5000, IHC:1:20-1:200, IF:1:50-1:200
CACNG3 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against CACNG3. Recognizes CACNG3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500
Cacng3/ Rat Cacng3 ELISA Kit
ELI-50225r 96 Tests
EUR 886
Polyclonal Cacng3 antibody - C-terminal region
AMM05667G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cacng3 - C-terminal region. This antibody is tested and proven to work in the following applications:
Anti-CACNG3 Antibody
A13931 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CACNG3 Antibody (CACNG3) detection. Tested with WB, IHC in Human, Mouse, Rat.
CACNG3 Conjugated Antibody
C46388 100ul
EUR 397
anti- CACNG3 antibody
FNab01179 100µg
EUR 548.75
  • Immunogen: calcium channel, voltage-dependent, gamma subunit 3
  • Uniprot ID: O60359
  • Gene ID: 10368
  • Research Area: Neuroscience
Description: Antibody raised against CACNG3
Anti-CACNG3 antibody
PAab01179 100 ug
EUR 386
Anti-CACNG3 antibody
STJ97417 200 µl
EUR 197
Description: Rabbit polyclonal to CACNG3.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA16904 50 ug
EUR 363
Description: Mouse polyclonal to CACNG3
YF-PA16905 100 ug
EUR 403
Description: Rabbit polyclonal to CACNG3
CACNG3 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CACNG3. Recognizes CACNG3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
CACNG3 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CACNG3. Recognizes CACNG3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
CACNG3 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CACNG3. Recognizes CACNG3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
CACNG3 cloning plasmid
CSB-CL004417HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 948
  • Sequence: atgaggatgtgtgacagaggtatccagatgttgatcaccactgtaggagcctttgccgcttttagtttaatgaccattgcagtgggcacggactactggttatattccagaggtgtgtgcaggactaaatctacaagtgataatgaaaccagcaggaagaatgaagaagtaatgac
  • Show more
Description: A cloning plasmid for the CACNG3 gene.
Anti-CACNG3 (3E4)
YF-MA17273 100 ug
EUR 363
Description: Mouse monoclonal to CACNG3
Mouse Cacng3 ELISA KIT
ELI-10792m 96 Tests
EUR 865
ELI-25092h 96 Tests
EUR 824
EF008328 96 Tests
EUR 689
Mouse CACNG3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat CACNG3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CACNG3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELI-50953b 96 Tests
EUR 928
CACNG3 Recombinant Protein (Human)
RP005428 100 ug Ask for price
CACNG3 Recombinant Protein (Rat)
RP192839 100 ug Ask for price
CACNG3 Recombinant Protein (Mouse)
RP120707 100 ug Ask for price
Monoclonal CACNG3 Antibody (monoclonal) (M01), Clone: 3E5
AMM05666G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CACNG3 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 3E5. This antibody is applicable in WB, E
Cacng3 ORF Vector (Rat) (pORF)
ORF064281 1.0 ug DNA
EUR 506
CACNG3 ORF Vector (Human) (pORF)
ORF001810 1.0 ug DNA
EUR 95
Cacng3 ORF Vector (Mouse) (pORF)
ORF040237 1.0 ug DNA
EUR 506
CACNG3 sgRNA CRISPR Lentivector set (Human)
K0352601 3 x 1.0 ug
EUR 339
Cacng3 sgRNA CRISPR Lentivector set (Rat)
K7058301 3 x 1.0 ug
EUR 339
Cacng3 sgRNA CRISPR Lentivector set (Mouse)
K3845001 3 x 1.0 ug
EUR 339
Voltage-Dependent Calcium Channel Gamma-3 Subunit (CACNG3) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Voltage-Dependent Calcium Channel Gamma-3 Subunit (CACNG3) Antibody
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Voltage-Dependent Calcium Channel Gamma-3 Subunit (CACNG3) Antibody
abx030103-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Voltage-Dependent Calcium Channel Gamma-3 Subunit (CACNG3) Antibody
abx030103-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Voltage-Dependent Calcium Channel Gamma-3 Subunit (CACNG3) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Voltage-Dependent Calcium Channel Gamma-3 Subunit (CACNG3) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Voltage-Dependent Calcium Channel Gamma-3 Subunit (CACNG3) Antibody
abx231179-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
CACNG3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0352602 1.0 ug DNA
EUR 154
CACNG3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0352603 1.0 ug DNA
EUR 154
CACNG3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0352604 1.0 ug DNA
EUR 154
Cacng3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7058302 1.0 ug DNA
EUR 154
Cacng3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7058303 1.0 ug DNA
EUR 154
Cacng3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7058304 1.0 ug DNA
EUR 154
Cacng3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3845002 1.0 ug DNA
EUR 154
Cacng3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3845003 1.0 ug DNA
EUR 154
Cacng3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3845004 1.0 ug DNA
EUR 154
CACNG3 Protein Vector (Mouse) (pPB-C-His)
PV160946 500 ng
EUR 603
CACNG3 Protein Vector (Mouse) (pPB-N-His)
PV160947 500 ng
EUR 603
CACNG3 Protein Vector (Mouse) (pPM-C-HA)
PV160948 500 ng
EUR 603
CACNG3 Protein Vector (Mouse) (pPM-C-His)
PV160949 500 ng
EUR 603
CACNG3 Protein Vector (Rat) (pPB-C-His)
PV257122 500 ng
EUR 603
CACNG3 Protein Vector (Rat) (pPB-N-His)
PV257123 500 ng
EUR 603
CACNG3 Protein Vector (Rat) (pPM-C-HA)
PV257124 500 ng
EUR 603
CACNG3 Protein Vector (Rat) (pPM-C-His)
PV257125 500 ng
EUR 603
CACNG3 Protein Vector (Human) (pPB-C-His)
PV007237 500 ng
EUR 329
CACNG3 Protein Vector (Human) (pPB-N-His)
PV007238 500 ng
EUR 329
CACNG3 Protein Vector (Human) (pPM-C-HA)
PV007239 500 ng
EUR 329
CACNG3 Protein Vector (Human) (pPM-C-His)
PV007240 500 ng
EUR 329
Cacng3 3'UTR GFP Stable Cell Line
TU153031 1.0 ml Ask for price
Cacng3 3'UTR Luciferase Stable Cell Line
TU103031 1.0 ml Ask for price
Cacng3 3'UTR Luciferase Stable Cell Line
TU201562 1.0 ml Ask for price
Cacng3 3'UTR GFP Stable Cell Line
TU251562 1.0 ml Ask for price

CACNG3 Rabbit Polyclonal Antibody