MYOZ2 Rabbit Polyclonal Antibody

MYOZ2 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

MYOZ2 Polyclonal Antibody
ABP57552-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 21-70
  • Applications tips:
Description: A polyclonal antibody for detection of MYOZ2 from Human, Mouse, Rat. This MYOZ2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 21-70
MYOZ2 Polyclonal Antibody
ABP57552-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 21-70
  • Applications tips:
Description: A polyclonal antibody for detection of MYOZ2 from Human, Mouse, Rat. This MYOZ2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 21-70
MYOZ2 Polyclonal Antibody
ES8545-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MYOZ2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
MYOZ2 Polyclonal Antibody
ES8545-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MYOZ2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Human Myozenin 2 (MYOZ2) ELISA Kit
DLR-MYOZ2-Hu-48T 48T
EUR 517
  • Should the Human Myozenin 2 (MYOZ2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myozenin 2 (MYOZ2) in samples from tissue homogenates or other biological fluids.
Human Myozenin 2 (MYOZ2) ELISA Kit
DLR-MYOZ2-Hu-96T 96T
EUR 673
  • Should the Human Myozenin 2 (MYOZ2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myozenin 2 (MYOZ2) in samples from tissue homogenates or other biological fluids.
Human Myozenin 2 (MYOZ2) ELISA Kit
RDR-MYOZ2-Hu-48Tests 48 Tests
EUR 544
Human Myozenin 2 (MYOZ2) ELISA Kit
RDR-MYOZ2-Hu-96Tests 96 Tests
EUR 756
Human Myozenin 2 (MYOZ2) ELISA Kit
RD-MYOZ2-Hu-48Tests 48 Tests
EUR 521
Human Myozenin 2 (MYOZ2) ELISA Kit
RD-MYOZ2-Hu-96Tests 96 Tests
EUR 723
MYOZ2 Rabbit pAb
A6468-100ul 100 ul
EUR 308
MYOZ2 Rabbit pAb
A6468-200ul 200 ul
EUR 459
MYOZ2 Rabbit pAb
A6468-20ul 20 ul
EUR 183
MYOZ2 Rabbit pAb
A6468-50ul 50 ul
EUR 223
MYOZ2 antibody
70R-18735 50 ul
EUR 435
Description: Rabbit polyclonal MYOZ2 antibody
MYOZ2 Antibody
47160-100ul 100ul
EUR 252
MYOZ2 antibody
38944-100ul 100ul
EUR 252
MYOZ2 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against MYOZ2. Recognizes MYOZ2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000
MYOZ2 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYOZ2. Recognizes MYOZ2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IF:1:50-1:200
MYOZ2 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MYOZ2. Recognizes MYOZ2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
Anti-MYOZ2 Antibody
A09739 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for MYOZ2 Antibody (MYOZ2) detection. Tested with WB in Human, Mouse, Rat.
MYOZ2 Conjugated Antibody
C38944 100ul
EUR 397
Anti-MYOZ2 antibody
STJ28551 100 µl
EUR 277
Description: The protein encoded by this gene belongs to a family of sarcomeric proteins that bind to calcineurin, a phosphatase involved in calcium-dependent signal transduction in diverse cell types. These family members tether calcineurin to alpha-actinin at the z-line of the sarcomere of cardiac and skeletal muscle cells, and thus they are important for calcineurin signaling. Mutations in this gene cause cardiomyopathy familial hypertrophic type 16, a hereditary heart disorder.
Anti-MYOZ2 antibody
STJ98658 200 µl
EUR 197
Description: Rabbit polyclonal to MYOZ2.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
MYOZ2 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYOZ2. Recognizes MYOZ2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
MYOZ2 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYOZ2. Recognizes MYOZ2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
MYOZ2 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYOZ2. Recognizes MYOZ2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Myozenin 2 (MYOZ2) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Myozenin 2 (MYOZ2) Antibody
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Myozenin 2 (MYOZ2) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Myozenin 2 (MYOZ2) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Myozenin 2 (MYOZ2) Antibody
abx029523-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Myozenin 2 (MYOZ2) Antibody
abx029523-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Myozenin 2 (MYOZ2) Antibody
abx235524-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Myozenin 2 (MYOZ2) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
MYOZ2 cloning plasmid
CSB-CL873609HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 795
  • Sequence: atgctatcacataatactatgatgaagcagagaaaacagcaagcaacagccatcatgaaggaagtccatggaaatgatgttgatggcatggacctgggcaaaaaggtcagcatccccagagacatcatgttggaagaattatcccatctcagtaaccgtggtgccaggctatttaa
  • Show more
Description: A cloning plasmid for the MYOZ2 gene.
MYOZ2 cloning plasmid
CSB-CL873609HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 795
  • Sequence: atgctatcacataatactatgatgaagcagagaaaacagcaagcaacagccatcatgaaggaagtccatggaaatgatgttgatggcatggacctgggcaaaaaggtcagcatccccagagacatcatgttggaagaattatcccatctcagtaaccgtggtgccaggctatttaa
  • Show more
Description: A cloning plasmid for the MYOZ2 gene.
Mouse MYOZ2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human MYOZ2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
MYOZ2 Recombinant Protein (Human)
RP020566 100 ug Ask for price
MYOZ2 Recombinant Protein (Human)
RP020569 100 ug Ask for price
MYOZ2 Recombinant Protein (Mouse)
RP152795 100 ug Ask for price
MYOZ2 Recombinant Protein (Rat)
RP213086 100 ug Ask for price
Human Myozenin 2 (MYOZ2) Protein
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Myoz2 ORF Vector (Rat) (pORF)
ORF071030 1.0 ug DNA
EUR 506
MYOZ2 ORF Vector (Human) (pORF)
ORF006856 1.0 ug DNA
EUR 95
MYOZ2 ORF Vector (Human) (pORF)
ORF006857 1.0 ug DNA
EUR 95
Myoz2 ORF Vector (Mouse) (pORF)
ORF050933 1.0 ug DNA
EUR 506
MYOZ2 ELISA Kit (Human) (OKCD09067)
OKCD09067 96 Wells
EUR 975
Description: Description of target: Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL
MYOZ2 ELISA Kit (Human) (OKDD00415)
OKDD00415 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene belongs to a family of sarcomeric proteins that bind to calcineurin, a phosphatase involved in calcium-dependent signal transduction in diverse cell types. These family members tether calcineurin to alpha-actinin at the z-line of the sarcomere of cardiac and skeletal muscle cells, and thus they are important for calcineurin signaling. Mutations in this gene cause cardiomyopathy familial hypertrophic type 16, a hereditary heart disorder.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.061 ng/mL
Human Myozenin 2 (MYOZ2) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Bovine Myozenin- 2, MYOZ2 ELISA KIT
ELI-13895b 96 Tests
EUR 928

MYOZ2 Rabbit Polyclonal Antibody