RHEB Rabbit Polyclonal Antibody

RHEB Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

Polyclonal RHEB Antibody
AMR09741G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RHEB . This antibody is tested and proven to work in the following applications:

RHEB Polyclonal Antibody
ABP57482-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide of RHEB
  • Applications tips:
Description: A polyclonal antibody for detection of RHEB from Human, Mouse, Rat, Cow. This RHEB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of RHEB

RHEB Polyclonal Antibody
ABP57482-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide of RHEB
  • Applications tips:
Description: A polyclonal antibody for detection of RHEB from Human, Mouse, Rat, Cow. This RHEB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of RHEB

RHEB Polyclonal Antibody
ABP57482-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide of RHEB
  • Applications tips:
Description: A polyclonal antibody for detection of RHEB from Human, Mouse, Rat, Cow. This RHEB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of RHEB

RHEB Polyclonal Antibody
ES8475-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RHEB from Human/Mouse/Rat/Cow. This antibody is tested and validated for WB, ELISA, WB, ELISA

RHEB Polyclonal Antibody
ES8475-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RHEB from Human/Mouse/Rat/Cow. This antibody is tested and validated for WB, ELISA, WB, ELISA

RHEB Rabbit pAb
A1165-100ul 100 ul
EUR 308

RHEB Rabbit pAb
A1165-200ul 200 ul
EUR 459

RHEB Rabbit pAb
A1165-20ul 20 ul
EUR 183

RHEB Rabbit pAb
A1165-50ul 50 ul
EUR 223

RHEB Rabbit mAb
A3702-100ul 100 ul
EUR 410

RHEB Rabbit mAb
A3702-200ul 200 ul
EUR 571

RHEB Rabbit mAb
A3702-20ul 20 ul
EUR 221

RHEB Rabbit mAb
A3702-50ul 50 ul
EUR 287

Rheb Antibody
24306-100ul 100ul
EUR 390

Rheb Antibody
24307-100ul 100ul
EUR 390

RHEB antibody
70R-19883 50 ul
EUR 435
Description: Rabbit polyclonal RHEB antibody

RHEB Antibody
32196-100ul 100ul
EUR 252

RHEB Antibody
49914-100ul 100ul
EUR 333

RHEB Antibody
49914-50ul 50ul
EUR 239

RHEB Antibody
42737-100ul 100ul
EUR 252

RHEB Antibody
1-CSB-PA072418
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

RHEB Antibody
1-CSB-PA077173
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

RHEB Antibody
1-CSB-PA088225
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

RHEB Antibody
1-CSB-PA124825
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

RHEB Antibody
1-CSB-PA624022LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RHEB Antibody
DF6299 200ul
EUR 304
Description: RHEB Antibody detects endogenous levels of total RHEB.

RHEB Antibody
1-CSB-PA442874
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

RHEB Antibody
1-CSB-PA256263
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

RHEB antibody
70R-5794 50 ug
EUR 467
Description: Rabbit polyclonal RHEB antibody raised against the middle region of RHEB

RHEB Antibody
1-CSB-PA019678GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RHEB Antibody
ABD6299 100 ug
EUR 438

Polyclonal RHEB Antibody (C-term)
AMR09752G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RHEB (C-term). This antibody is tested and proven to work in the following applications:

RHEB
RA30052 50 ug
EUR 618

Human Rheb Antibody
32694-05111 150 ug
EUR 261

RHEB Conjugated Antibody
C49914 100ul
EUR 397

RHEB Conjugated Antibody
C32196 100ul
EUR 397

anti- RHEB antibody
FNab07280 100µg
EUR 548.75
  • Immunogen: Ras homolog enriched in brain
  • Uniprot ID: Q15382
  • Gene ID: 6009
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against RHEB

Anti-RHEB antibody
PAab07280 100 ug
EUR 386

Anti-RHEB antibody
STJ25350 100 µl
EUR 277
Description: This gene is a member of the small GTPase superfamily and encodes a lipid-anchored, cell membrane protein with five repeats of the RAS-related GTP-binding region. This protein is vital in regulation of growth and cell cycle progression due to its role in the insulin/TOR/S6K signaling pathway. The protein has GTPase activity and shuttles between a GDP-bound form and a GTP-bound form, and farnesylation of the protein is required for this activity. Three pseudogenes have been mapped, two on chromosome 10 and one on chromosome 22.

Anti-RHEB antibody
STJ98588 200 µl
EUR 197
Description: RHEB is a protein encoded by the RHEB gene which is approximately 20,5 kDa. RHEB is localised to the cytoplasm, Golgi apparatus membrane, cytosol and endoplasmic reticulum membrane. It is involved in the regulation of lipid metabolism, insulin signalling-generic cascades, mTOR signalling, RET signalling, AMP-activated protein kinase signalling and the phospholipase D signalling pathway. The RHEB gene is a member of the small GTPase superfamily and encodes the lipid-anchored, cell membrane protein, RHEB. This protein is vital in regulation of growth and cell cycle progression. RHEB is ubiquitous expressed with highest levels observed in skeletal and cardiac muscle. Mutations in the RHEB can result in tuberous sclerosis. STJ98588 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This polyclonal antibody binds to endogenous levels of RHEB.

Rheb/ Rat Rheb ELISA Kit
ELI-45205r 96 Tests
EUR 886

RHEB siRNA
20-abx904568
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RHEB siRNA
20-abx931459
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RHEB siRNA
20-abx931460
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RHEB
YF-PA14387 50 ul
EUR 363
Description: Mouse polyclonal to RHEB

anti-RHEB
YF-PA14388 50 ug
EUR 363
Description: Mouse polyclonal to RHEB

anti-RHEB
YF-PA14389 100 ul
EUR 403
Description: Rabbit polyclonal to RHEB

anti-RHEB
YF-PA14390 100 ug
EUR 403
Description: Rabbit polyclonal to RHEB

RHEB Antibody, HRP conjugated
1-CSB-PA624022LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RHEB Antibody, FITC conjugated
1-CSB-PA624022LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RHEB Antibody, Biotin conjugated
1-CSB-PA624022LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse GTP- binding protein Rheb, Rheb ELISA KIT
ELI-19245m 96 Tests
EUR 865

Human GTP- binding protein Rheb, RHEB ELISA KIT
ELI-30320h 96 Tests
EUR 824

Bovine GTP- binding protein Rheb, RHEB ELISA KIT
ELI-52257b 96 Tests
EUR 928

RHEB Blocking Peptide
33R-9564 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RHEB antibody, catalog no. 70R-5794

RHEB Blocking Peptide
DF6299-BP 1mg
EUR 195

RHEB cloning plasmid
CSB-CL624022HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Sequence: atgccgcagtccaagtcccggaagatcgcgatcctgggctaccggtctgtggggaaatcctcattgacgattcaatttgttgaaggccaatttgtggactcctacgatccaaccatagaaaacacttttacaaagttgatcacagtaaatggacaagaatatcatcttcaacttgt
  • Show more
Description: A cloning plasmid for the RHEB gene.

RHEB cloning plasmid
CSB-CL624022HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Sequence: atgccgcagtccaagtcccggaagatcgcgatcctgggctaccggtctgtggggaaatcctcattgacgattcaatttgttgaaggccaatttgtggactcctacgatccaaccatagaaaacacttttacaaagttgatcacagtaaatggacaagaatatcatcttcaacttgt
  • Show more
Description: A cloning plasmid for the RHEB gene.

Recombinant Human Rheb
P0391 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: Q15382
Description: Recombinant Human protein for Rheb

Anti-RHEB (2C11)
YF-MA10784 100 ug
EUR 363
Description: Mouse monoclonal to RHEB

Anti-RHEB (1E12)
YF-MA15193 100 ug
EUR 363
Description: Mouse monoclonal to RHEB

Human Rheb Antibody (Biotin Conjugate)
32694-05121 150 ug
EUR 369

Monoclonal Rheb Antibody, Clone: EPR2971
AMR09740G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human Rheb. The antibodies are raised in Rabbit and are from clone EPR2971. This antibody is applicable in WB and IHC

Recombinant Human GTP-Binding Protein Rheb/RHEB (N-GST)
CG22-10ug 10ug
EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris, 10mM GSH, pH 8.0.

Recombinant Human GTP-Binding Protein Rheb/RHEB (N-GST)
CG22-1mg 1mg
EUR 2486
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris, 10mM GSH, pH 8.0.

Recombinant Human GTP-Binding Protein Rheb/RHEB (N-GST)
CG22-500ug 500ug
EUR 1755
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris, 10mM GSH, pH 8.0.

Recombinant Human GTP-Binding Protein Rheb/RHEB (N-GST)
CG22-50ug 50ug
EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris, 10mM GSH, pH 8.0.

Human Rheb AssayLite Antibody (FITC Conjugate)
32694-05141 150 ug
EUR 428

Human Rheb AssayLite Antibody (RPE Conjugate)
32694-05151 150 ug
EUR 428

Human Rheb AssayLite Antibody (APC Conjugate)
32694-05161 150 ug
EUR 428

Human Rheb AssayLite Antibody (PerCP Conjugate)
32694-05171 150 ug
EUR 471

RheB protein (T7 tag)
80R-1076 100 ug
EUR 224
Description: Purified recombinant Human RheB protein (T7 tag)

RHEB ELISA KIT|Human
EF002449 96 Tests
EUR 689

Mouse RHEB shRNA Plasmid
20-abx972457
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RHEB shRNA Plasmid
20-abx985288
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RHEB shRNA Plasmid
20-abx954076
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCDNA3.1- RHEB- Q60K- Myc
PVT10370 2 ug
EUR 266

pCDNA3.1- RHEB- Q64L- Myc
PVT10371 2 ug
EUR 266

RHEB Recombinant Protein (Human)
RP026371 100 ug Ask for price

RHEB Recombinant Protein (Human)
RP026374 100 ug Ask for price

RHEB Recombinant Protein (Mouse)
RP167990 100 ug Ask for price

RHEB Recombinant Protein (Rat)
RP226019 100 ug Ask for price

Ras Homolog Enriched In Brain (RHEB) Antibody
abx026430-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody
abx026430-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody
20-abx214387
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody
20-abx214959
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody
20-abx214960
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody
20-abx213656
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody
20-abx213657
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody
20-abx115059
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody
abx145070-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody
20-abx142196
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody
20-abx242233
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody
abx237280-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody
20-abx313390
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody
20-abx001079
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rheb ORF Vector (Rat) (pORF)
ORF075341 1.0 ug DNA
EUR 506

RHEB ORF Vector (Human) (pORF)
ORF008791 1.0 ug DNA
EUR 95

RHEB ORF Vector (Human) (pORF)
ORF008792 1.0 ug DNA
EUR 95

Rheb ORF Vector (Mouse) (pORF)
ORF055998 1.0 ug DNA
EUR 506

Ras Homolog Enriched In Brain (RHEB) Antibody (HRP)
20-abx313391
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody (FITC)
20-abx313392
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody (Biotin)
20-abx313393
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rheb sgRNA CRISPR Lentivector set (Rat)
K6822501 3 x 1.0 ug
EUR 339

RHEB sgRNA CRISPR Lentivector set (Human)
K1820301 3 x 1.0 ug
EUR 339

Rheb sgRNA CRISPR Lentivector set (Mouse)
K4604901 3 x 1.0 ug
EUR 339

Ras Homolog Enriched In Brain (RHEB) Protein
20-abx260430
  • EUR 230.00
  • EUR 2332.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

Rheb sgRNA CRISPR Lentivector (Rat) (Target 1)
K6822502 1.0 ug DNA
EUR 154

Rheb sgRNA CRISPR Lentivector (Rat) (Target 2)
K6822503 1.0 ug DNA
EUR 154

Rheb sgRNA CRISPR Lentivector (Rat) (Target 3)
K6822504 1.0 ug DNA
EUR 154

RHEB sgRNA CRISPR Lentivector (Human) (Target 1)
K1820302 1.0 ug DNA
EUR 154

RHEB sgRNA CRISPR Lentivector (Human) (Target 2)
K1820303 1.0 ug DNA
EUR 154

RHEB sgRNA CRISPR Lentivector (Human) (Target 3)
K1820304 1.0 ug DNA
EUR 154

Rheb sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4604902 1.0 ug DNA
EUR 154

Rheb sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4604903 1.0 ug DNA
EUR 154

Rheb sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4604904 1.0 ug DNA
EUR 154

RHEB Protein Vector (Rat) (pPB-C-His)
PV301362 500 ng
EUR 603

RHEB Protein Vector (Rat) (pPB-N-His)
PV301363 500 ng
EUR 603

RHEB Protein Vector (Rat) (pPM-C-HA)
PV301364 500 ng
EUR 603

RHEB Protein Vector (Rat) (pPM-C-His)
PV301365 500 ng
EUR 603

RHEB Protein Vector (Human) (pPB-C-His)
PV035161 500 ng
EUR 329

RHEB Protein Vector (Human) (pPB-N-His)
PV035162 500 ng
EUR 329

RHEB Protein Vector (Human) (pPM-C-HA)
PV035163 500 ng
EUR 329

RHEB Protein Vector (Human) (pPM-C-His)
PV035164 500 ng
EUR 329

RHEB Protein Vector (Human) (pPB-C-His)
PV035165 500 ng
EUR 329

RHEB Protein Vector (Human) (pPB-N-His)
PV035166 500 ng
EUR 329

RHEB Protein Vector (Human) (pPM-C-HA)
PV035167 500 ng
EUR 329

RHEB Protein Vector (Human) (pPM-C-His)
PV035168 500 ng
EUR 329

RHEB Protein Vector (Mouse) (pPB-C-His)
PV223990 500 ng
EUR 603

RHEB Protein Vector (Mouse) (pPB-N-His)
PV223991 500 ng
EUR 603

RHEB Protein Vector (Mouse) (pPM-C-HA)
PV223992 500 ng
EUR 603

RHEB Protein Vector (Mouse) (pPM-C-His)
PV223993 500 ng
EUR 603

Recombinant Human RHEB Protein, Untagged, E.coli-10ug
QP13313-10ug 10ug
EUR 155

Recombinant Human RHEB Protein, Untagged, E.coli-1mg
QP13313-1mg 1mg
EUR 1859

Recombinant Human RHEB Protein, Untagged, E.coli-50ug
QP13313-50ug 50ug
EUR 201

Rheb 3'UTR Luciferase Stable Cell Line
TU117824 1.0 ml Ask for price

Rheb 3'UTR GFP Stable Cell Line
TU167824 1.0 ml Ask for price

Rheb 3'UTR Luciferase Stable Cell Line
TU219399 1.0 ml Ask for price

Rheb 3'UTR GFP Stable Cell Line
TU269399 1.0 ml Ask for price

RHEB 3'UTR GFP Stable Cell Line
TU069873 1.0 ml
EUR 1394

RHEB 3'UTR Luciferase Stable Cell Line
TU019873 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

RHEB Rabbit Polyclonal Antibody