RHEB Rabbit Polyclonal Antibody

RHEB Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

Polyclonal RHEB Antibody

AMR09741G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RHEB . This antibody is tested and proven to work in the following applications:

RHEB Polyclonal Antibody

ES8475-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RHEB from Human/Mouse/Rat/Cow. This antibody is tested and validated for WB, ELISA, WB, ELISA

RHEB Polyclonal Antibody

ES8475-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RHEB from Human/Mouse/Rat/Cow. This antibody is tested and validated for WB, ELISA, WB, ELISA

RHEB Polyclonal Antibody

ABP57482-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide of RHEB
  • Applications tips:
Description: A polyclonal antibody for detection of RHEB from Human, Mouse, Rat, Cow. This RHEB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of RHEB

RHEB Polyclonal Antibody

ABP57482-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide of RHEB
  • Applications tips:
Description: A polyclonal antibody for detection of RHEB from Human, Mouse, Rat, Cow. This RHEB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of RHEB

RHEB Polyclonal Antibody

ABP57482-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide of RHEB
  • Applications tips:
Description: A polyclonal antibody for detection of RHEB from Human, Mouse, Rat, Cow. This RHEB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of RHEB

RHEB Rabbit pAb

A1165-100ul 100 ul
EUR 308

RHEB Rabbit pAb

A1165-200ul 200 ul
EUR 459

RHEB Rabbit pAb

A1165-20ul 20 ul
EUR 183

RHEB Rabbit pAb

A1165-50ul 50 ul
EUR 223

RHEB Rabbit mAb

A3702-100ul 100 ul
EUR 410

RHEB Rabbit mAb

A3702-200ul 200 ul
EUR 571

RHEB Rabbit mAb

A3702-20ul 20 ul
EUR 221

RHEB Rabbit mAb

A3702-50ul 50 ul
EUR 287

RHEB antibody

70R-5794 50 ug
EUR 467
Description: Rabbit polyclonal RHEB antibody raised against the middle region of RHEB

RHEB Antibody

ABD6299 100 ug
EUR 438

RHEB Antibody

49914-100ul 100ul
EUR 333

RHEB Antibody

49914-50ul 50ul
EUR 239

RHEB Antibody

42737-100ul 100ul
EUR 252

RHEB Antibody

32196-100ul 100ul
EUR 252

Rheb Antibody

24306-100ul 100ul
EUR 390

Rheb Antibody

24307-100ul 100ul
EUR 390

RHEB antibody

70R-19883 50 ul
EUR 435
Description: Rabbit polyclonal RHEB antibody

RHEB Antibody

DF6299 200ul
EUR 304
Description: RHEB Antibody detects endogenous levels of total RHEB.

RHEB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RHEB Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

RHEB Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

RHEB Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

RHEB Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

RHEB Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

RHEB Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

RHEB Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal RHEB Antibody (C-term)

AMR09752G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RHEB (C-term). This antibody is tested and proven to work in the following applications:


RA30052 50 ug
EUR 618

RHEB Conjugated Antibody

C49914 100ul
EUR 397

RHEB Conjugated Antibody

C32196 100ul
EUR 397

anti- RHEB antibody

FNab07280 100µg
EUR 548.75
  • Immunogen: Ras homolog enriched in brain
  • Uniprot ID: Q15382
  • Gene ID: 6009
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against RHEB

Human Rheb Antibody

32694-05111 150 ug
EUR 261

Anti-RHEB antibody

PAab07280 100 ug
EUR 386

Anti-RHEB antibody

STJ98588 200 µl
EUR 197
Description: RHEB is a protein encoded by the RHEB gene which is approximately 20,5 kDa. RHEB is localised to the cytoplasm, Golgi apparatus membrane, cytosol and endoplasmic reticulum membrane. It is involved in the regulation of lipid metabolism, insulin signalling-generic cascades, mTOR signalling, RET signalling, AMP-activated protein kinase signalling and the phospholipase D signalling pathway. The RHEB gene is a member of the small GTPase superfamily and encodes the lipid-anchored, cell membrane protein, RHEB. This protein is vital in regulation of growth and cell cycle progression. RHEB is ubiquitous expressed with highest levels observed in skeletal and cardiac muscle. Mutations in the RHEB can result in tuberous sclerosis. STJ98588 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This polyclonal antibody binds to endogenous levels of RHEB.

Anti-RHEB antibody

STJ25350 100 µl
EUR 277
Description: This gene is a member of the small GTPase superfamily and encodes a lipid-anchored, cell membrane protein with five repeats of the RAS-related GTP-binding region. This protein is vital in regulation of growth and cell cycle progression due to its role in the insulin/TOR/S6K signaling pathway. The protein has GTPase activity and shuttles between a GDP-bound form and a GTP-bound form, and farnesylation of the protein is required for this activity. Three pseudogenes have been mapped, two on chromosome 10 and one on chromosome 22.

Rheb/ Rat Rheb ELISA Kit

ELI-45205r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA14387 50 ul
EUR 363
Description: Mouse polyclonal to RHEB


YF-PA14388 50 ug
EUR 363
Description: Mouse polyclonal to RHEB


YF-PA14389 100 ul
EUR 403
Description: Rabbit polyclonal to RHEB


YF-PA14390 100 ug
EUR 403
Description: Rabbit polyclonal to RHEB

RHEB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RHEB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RHEB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse GTP- binding protein Rheb, Rheb ELISA KIT

ELI-19245m 96 Tests
EUR 865

Bovine GTP- binding protein Rheb, RHEB ELISA KIT

ELI-52257b 96 Tests
EUR 928

Human GTP- binding protein Rheb, RHEB ELISA KIT

ELI-30320h 96 Tests
EUR 824

RHEB Blocking Peptide

33R-9564 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RHEB antibody, catalog no. 70R-5794

RHEB Blocking Peptide

DF6299-BP 1mg
EUR 195

RHEB cloning plasmid

CSB-CL624022HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Sequence: atgccgcagtccaagtcccggaagatcgcgatcctgggctaccggtctgtggggaaatcctcattgacgattcaatttgttgaaggccaatttgtggactcctacgatccaaccatagaaaacacttttacaaagttgatcacagtaaatggacaagaatatcatcttcaacttgt
  • Show more
Description: A cloning plasmid for the RHEB gene.

RHEB cloning plasmid

CSB-CL624022HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Sequence: atgccgcagtccaagtcccggaagatcgcgatcctgggctaccggtctgtggggaaatcctcattgacgattcaatttgttgaaggccaatttgtggactcctacgatccaaccatagaaaacacttttacaaagttgatcacagtaaatggacaagaatatcatcttcaacttgt
  • Show more
Description: A cloning plasmid for the RHEB gene.

Recombinant Human Rheb

P0391 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: Q15382
Description: Recombinant Human protein for Rheb

Anti-RHEB (1E12)

YF-MA15193 100 ug
EUR 363
Description: Mouse monoclonal to RHEB

Anti-RHEB (2C11)

YF-MA10784 100 ug
EUR 363
Description: Mouse monoclonal to RHEB

Monoclonal Rheb Antibody, Clone: EPR2971

AMR09740G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human Rheb. The antibodies are raised in Rabbit and are from clone EPR2971. This antibody is applicable in WB and IHC

Human Rheb Antibody (Biotin Conjugate)

32694-05121 150 ug
EUR 369

Recombinant Human GTP-Binding Protein Rheb/RHEB (N-GST)

CG22-10ug 10ug
EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris, 10mM GSH, pH 8.0.

Recombinant Human GTP-Binding Protein Rheb/RHEB (N-GST)

CG22-1mg 1mg
EUR 2486
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris, 10mM GSH, pH 8.0.

Recombinant Human GTP-Binding Protein Rheb/RHEB (N-GST)

CG22-500ug 500ug
EUR 1755
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris, 10mM GSH, pH 8.0.

Recombinant Human GTP-Binding Protein Rheb/RHEB (N-GST)

CG22-50ug 50ug
EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris, 10mM GSH, pH 8.0.

Human Rheb AssayLite Antibody (FITC Conjugate)

32694-05141 150 ug
EUR 428

Human Rheb AssayLite Antibody (RPE Conjugate)

32694-05151 150 ug
EUR 428

Human Rheb AssayLite Antibody (APC Conjugate)

32694-05161 150 ug
EUR 428

Human Rheb AssayLite Antibody (PerCP Conjugate)

32694-05171 150 ug
EUR 471

Rat RHEB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF002449 96 Tests
EUR 689

Human RHEB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RheB protein (T7 tag)

80R-1076 100 ug
EUR 224
Description: Purified recombinant Human RheB protein (T7 tag)

Mouse RHEB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RHEB Recombinant Protein (Human)

RP026371 100 ug Ask for price

RHEB Recombinant Protein (Human)

RP026374 100 ug Ask for price

RHEB Recombinant Protein (Rat)

RP226019 100 ug Ask for price

pCDNA3.1- RHEB- Q60K- Myc

PVT10370 2 ug
EUR 266

pCDNA3.1- RHEB- Q64L- Myc

PVT10371 2 ug
EUR 266

RHEB Recombinant Protein (Mouse)

RP167990 100 ug Ask for price

Ras Homolog Enriched In Brain (RHEB) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody

abx145070-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody

abx026430-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody

abx026430-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody

abx237280-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RHEB ORF Vector (Human) (pORF)

ORF008791 1.0 ug DNA
EUR 95

RHEB ORF Vector (Human) (pORF)

ORF008792 1.0 ug DNA
EUR 95

Rheb ORF Vector (Mouse) (pORF)

ORF055998 1.0 ug DNA
EUR 506

Rheb ORF Vector (Rat) (pORF)

ORF075341 1.0 ug DNA
EUR 506

Ras Homolog Enriched In Brain (RHEB) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ras Homolog Enriched In Brain (RHEB) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RHEB sgRNA CRISPR Lentivector set (Human)

K1820301 3 x 1.0 ug
EUR 339

Rheb sgRNA CRISPR Lentivector set (Mouse)

K4604901 3 x 1.0 ug
EUR 339

Rheb sgRNA CRISPR Lentivector set (Rat)

K6822501 3 x 1.0 ug
EUR 339

Ras Homolog Enriched In Brain (RHEB) Protein

  • EUR 230.00
  • EUR 2332.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

RHEB sgRNA CRISPR Lentivector (Human) (Target 1)

K1820302 1.0 ug DNA
EUR 154

RHEB sgRNA CRISPR Lentivector (Human) (Target 2)

K1820303 1.0 ug DNA
EUR 154

RHEB sgRNA CRISPR Lentivector (Human) (Target 3)

K1820304 1.0 ug DNA
EUR 154

Rheb sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4604902 1.0 ug DNA
EUR 154

Rheb sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4604903 1.0 ug DNA
EUR 154

Rheb sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4604904 1.0 ug DNA
EUR 154

Rheb sgRNA CRISPR Lentivector (Rat) (Target 1)

K6822502 1.0 ug DNA
EUR 154

Rheb sgRNA CRISPR Lentivector (Rat) (Target 2)

K6822503 1.0 ug DNA
EUR 154

Rheb sgRNA CRISPR Lentivector (Rat) (Target 3)

K6822504 1.0 ug DNA
EUR 154

RHEB Protein Vector (Human) (pPB-C-His)

PV035161 500 ng
EUR 329

RHEB Protein Vector (Human) (pPB-N-His)

PV035162 500 ng
EUR 329

RHEB Protein Vector (Human) (pPM-C-HA)

PV035163 500 ng
EUR 329

RHEB Protein Vector (Human) (pPM-C-His)

PV035164 500 ng
EUR 329

RHEB Protein Vector (Human) (pPB-C-His)

PV035165 500 ng
EUR 329

RHEB Protein Vector (Human) (pPB-N-His)

PV035166 500 ng
EUR 329

RHEB Protein Vector (Human) (pPM-C-HA)

PV035167 500 ng
EUR 329

RHEB Protein Vector (Human) (pPM-C-His)

PV035168 500 ng
EUR 329

Recombinant Human RHEB Protein, Untagged, E.coli-10ug

QP13313-10ug 10ug
EUR 155

Recombinant Human RHEB Protein, Untagged, E.coli-1mg

QP13313-1mg 1mg
EUR 1859

Recombinant Human RHEB Protein, Untagged, E.coli-50ug

QP13313-50ug 50ug
EUR 201

RHEB Protein Vector (Rat) (pPB-C-His)

PV301362 500 ng
EUR 603

RHEB Protein Vector (Rat) (pPB-N-His)

PV301363 500 ng
EUR 603

RHEB Protein Vector (Rat) (pPM-C-HA)

PV301364 500 ng
EUR 603

RHEB Protein Vector (Rat) (pPM-C-His)

PV301365 500 ng
EUR 603

RHEB Protein Vector (Mouse) (pPB-C-His)

PV223990 500 ng
EUR 603

RHEB Protein Vector (Mouse) (pPB-N-His)

PV223991 500 ng
EUR 603

RHEB Protein Vector (Mouse) (pPM-C-HA)

PV223992 500 ng
EUR 603

RHEB Protein Vector (Mouse) (pPM-C-His)

PV223993 500 ng
EUR 603

Rheb 3'UTR GFP Stable Cell Line

TU167824 1.0 ml Ask for price

RHEB 3'UTR Luciferase Stable Cell Line

TU019873 1.0 ml
EUR 1394

Rheb 3'UTR Luciferase Stable Cell Line

TU117824 1.0 ml Ask for price

RHEB 3'UTR GFP Stable Cell Line

TU069873 1.0 ml
EUR 1394

Rheb 3'UTR Luciferase Stable Cell Line

TU219399 1.0 ml Ask for price

Rheb 3'UTR GFP Stable Cell Line

TU269399 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

RHEB Rabbit Polyclonal Antibody