RASSF2 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

Polyclonal RASSF2 Antibody
APG01069G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human RASSF2 . This antibody is tested and proven to work in the following applications:

RASSF2 Polyclonal Antibody
ABP57099-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human RASSF2 at AA range: 80-160 Applications tips:
Description: A polyclonal antibody for detection of RASSF2 from Human, Mouse, Rat. This RASSF2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human RASSF2 at AA range: 80-160

RASSF2 Polyclonal Antibody
ABP57099-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human RASSF2 at AA range: 80-160 Applications tips:
Description: A polyclonal antibody for detection of RASSF2 from Human, Mouse, Rat. This RASSF2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human RASSF2 at AA range: 80-160

RASSF2 Polyclonal Antibody
ABP57099-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human RASSF2 at AA range: 80-160 Applications tips:
Description: A polyclonal antibody for detection of RASSF2 from Human, Mouse, Rat. This RASSF2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human RASSF2 at AA range: 80-160

RASSF2 Polyclonal Antibody
ES8098-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against RASSF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RASSF2 Polyclonal Antibody
ES8098-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against RASSF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RASSF2 Rabbit pAb
A15766-100ul	Abclonal	100 ul	EUR 308

RASSF2 Rabbit pAb
A15766-200ul	Abclonal	200 ul	EUR 459

RASSF2 Rabbit pAb
A15766-20ul	Abclonal	20 ul	EUR 183

RASSF2 Rabbit pAb
A15766-50ul	Abclonal	50 ul	EUR 223

RASSF2 Rabbit pAb
A15767-100ul	Abclonal	100 ul	EUR 308

RASSF2 Rabbit pAb
A15767-200ul	Abclonal	200 ul	EUR 459

RASSF2 Rabbit pAb
A15767-20ul	Abclonal	20 ul	EUR 183

RASSF2 Rabbit pAb
A15767-50ul	Abclonal	50 ul	EUR 223

Polyclonal RASSF2 Antibody (Center)
APR04840G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RASSF2 (Center). This antibody is tested and proven to work in the following applications:

RASSF2 Polyclonal Conjugated Antibody
C29412	SAB	100ul	EUR 397

RASSF2 Polyclonal Conjugated Antibody
C29413	SAB	100ul	EUR 397

RASSF2 antibody
23100-100ul	SAB	100ul	EUR 390

RASSF2 antibody
70R-13076	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal RASSF2 antibody

RASSF2 Antibody
1-CSB-PA080062	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RASSF2. Recognizes RASSF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

RASSF2 Antibody
DF8437	Affbiotech	200ul	EUR 304
Description: RASSF2 Antibody detects endogenous levels of total RASSF2.

RASSF2 antibody
70R-50740	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal RASSF2 antibody

RASSF2 Antibody
1-CSB-PA019374LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RASSF2. Recognizes RASSF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IP; Recommended dilution: WB:1:1000-1:5000, IP:1:200-1:2000

RASSF2 Antibody
ABD8437	Lifescience Market	100 ug	EUR 438

Polyclonal RASSF2 Antibody (N-Term)
APR04839G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RASSF2 (N-Term). This antibody is tested and proven to work in the following applications:

Rassf2/ Rat Rassf2 ELISA Kit
ELI-14099r	Lifescience Market	96 Tests	EUR 886

Anti-RASSF2 antibody
STJ118225	St John's Laboratory	100 µl	EUR 277

Anti-RASSF2 antibody
STJ118226	St John's Laboratory	100 µl	EUR 277

Anti-RASSF2 antibody
STJ95376	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to RASSF2.

RASSF2 siRNA
20-abx904480	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RASSF2 siRNA
20-abx930966	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RASSF2 siRNA
20-abx930967	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RASSF2 Antibody, HRP conjugated
1-CSB-PA019374LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RASSF2. Recognizes RASSF2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RASSF2 Antibody, FITC conjugated
1-CSB-PA019374LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RASSF2. Recognizes RASSF2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RASSF2 Antibody, Biotin conjugated
1-CSB-PA019374LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RASSF2. Recognizes RASSF2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RASSF2 Blocking Peptide
DF8437-BP	Affbiotech	1mg	EUR 195

RASSF2 Blocking Peptide
20-abx063615	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

RASSF2 cloning plasmid
CSB-CL019374HU-10ug	Cusabio	10ug	EUR 384
Formulation: 10 μg plasmid + 200μl Glycerol Length: 981 Sequence: atggactacagccaccaaacgtccctagtcccatgtggacaagataaatacatttccaaaaatgaacttctcttgcatctgaagacctacaacttgtactatgaaggccagaatttacagctccggcaccgggaggaagaagacgagttcattgtggaggggctcctgaacatctc Show more
Description: A cloning plasmid for the RASSF2 gene.

Monoclonal RASSF2 Antibody, Clone: 1509CT269.10.9.29
AMM02545G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human RASSF2. The antibodies are raised in Mouse and are from clone 1509CT269.10.9.29. This antibody is applicable in FC, WB, E

Human RASSF2 ELISA KIT
ELI-42789h	Lifescience Market	96 Tests	EUR 824

Rat RASSF2 shRNA Plasmid
20-abx989674	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RASSF2 shRNA Plasmid
20-abx956533	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse RASSF2 shRNA Plasmid
20-abx980942	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Rassf2 ELISA KIT
ELI-39170m	Lifescience Market	96 Tests	EUR 865

RASSF2 Recombinant Protein (Human)
RP042757	ABM	100 ug	Ask for price

RASSF2 Recombinant Protein (Mouse)
RP166970	ABM	100 ug	Ask for price

RASSF2 Recombinant Protein (Rat)
RP223718	ABM	100 ug	Ask for price

Rassf2 ORF Vector (Rat) (pORF)
ORF074574	ABM	1.0 ug DNA	EUR 506

RASSF2 ORF Vector (Human) (pORF)
ORF014253	ABM	1.0 ug DNA	EUR 354

Rassf2 ORF Vector (Mouse) (pORF)
ORF055658	ABM	1.0 ug DNA	EUR 506

Ras Association Domain Family Member 2 (RASSF2) Antibody
20-abx008392	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Ras Association Domain Family Member 2 (RASSF2) Antibody
abx145079-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Ras Association Domain Family Member 2 (RASSF2) Antibody
20-abx327652	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Rassf2 sgRNA CRISPR Lentivector set (Rat)
K7318101	ABM	3 x 1.0 ug	EUR 339

RASSF2 sgRNA CRISPR Lentivector set (Human)
K1789801	ABM	3 x 1.0 ug	EUR 339

Rassf2 sgRNA CRISPR Lentivector set (Mouse)
K4064401	ABM	3 x 1.0 ug	EUR 339

Rassf2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7318102	ABM	1.0 ug DNA	EUR 154

Rassf2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7318103	ABM	1.0 ug DNA	EUR 154

Rassf2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7318104	ABM	1.0 ug DNA	EUR 154

RASSF2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1789802	ABM	1.0 ug DNA	EUR 154

RASSF2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1789803	ABM	1.0 ug DNA	EUR 154

RASSF2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1789804	ABM	1.0 ug DNA	EUR 154

Rassf2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4064402	ABM	1.0 ug DNA	EUR 154

Rassf2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4064403	ABM	1.0 ug DNA	EUR 154

Rassf2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4064404	ABM	1.0 ug DNA	EUR 154

RASSF2 Protein Vector (Rat) (pPB-C-His)
PV298294	ABM	500 ng	EUR 603

RASSF2 Protein Vector (Rat) (pPB-N-His)
PV298295	ABM	500 ng	EUR 603

RASSF2 Protein Vector (Rat) (pPM-C-HA)
PV298296	ABM	500 ng	EUR 603

RASSF2 Protein Vector (Rat) (pPM-C-His)
PV298297	ABM	500 ng	EUR 603

RASSF2 Protein Vector (Human) (pPB-C-His)
PV057009	ABM	500 ng	EUR 481

RASSF2 Protein Vector (Human) (pPB-N-His)
PV057010	ABM	500 ng	EUR 481

RASSF2 Protein Vector (Human) (pPM-C-HA)
PV057011	ABM	500 ng	EUR 481

RASSF2 Protein Vector (Human) (pPM-C-His)
PV057012	ABM	500 ng	EUR 481

RASSF2 Protein Vector (Mouse) (pPB-C-His)
PV222630	ABM	500 ng	EUR 603

RASSF2 Protein Vector (Mouse) (pPB-N-His)
PV222631	ABM	500 ng	EUR 603

RASSF2 Protein Vector (Mouse) (pPM-C-HA)
PV222632	ABM	500 ng	EUR 603

RASSF2 Protein Vector (Mouse) (pPM-C-His)
PV222633	ABM	500 ng	EUR 603

Rassf2 3'UTR Luciferase Stable Cell Line
TU117575	ABM	1.0 ml	Ask for price

Rassf2 3'UTR GFP Stable Cell Line
TU167575	ABM	1.0 ml	Ask for price

Rassf2 3'UTR Luciferase Stable Cell Line
TU217343	ABM	1.0 ml	Ask for price

Rassf2 3'UTR GFP Stable Cell Line
TU267343	ABM	1.0 ml	Ask for price

RASSF2 3'UTR GFP Stable Cell Line
TU069553	ABM	1.0 ml	EUR 2333

RASSF2 3'UTR Luciferase Stable Cell Line
TU019553	ABM	1.0 ml	EUR 2333

RASSF2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV653011	ABM	1.0 ug DNA	EUR 514

RASSF2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV653015	ABM	1.0 ug DNA	EUR 514

RASSF2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV653016	ABM	1.0 ug DNA	EUR 514

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

RASSF2 Rabbit Polyclonal Antibody