Cdc5L Rabbit Polyclonal Antibody

Cdc5L Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

Cdc5L Polyclonal Antibody
ABP57119-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Cdc5L at AA range: 690-770
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc5L from Human, Mouse, Rat. This Cdc5L antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Cdc5L at AA range: 690-770

Cdc5L Polyclonal Antibody
ABP57119-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Cdc5L at AA range: 690-770
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc5L from Human, Mouse, Rat. This Cdc5L antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Cdc5L at AA range: 690-770

Cdc5L Polyclonal Antibody
ABP57119-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Cdc5L at AA range: 690-770
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc5L from Human, Mouse, Rat. This Cdc5L antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Cdc5L at AA range: 690-770

CDC5L Rabbit pAb
A5560-100ul 100 ul
EUR 308

CDC5L Rabbit pAb
A5560-200ul 200 ul
EUR 459

CDC5L Rabbit pAb
A5560-20ul 20 ul
EUR 183

CDC5L Rabbit pAb
A5560-50ul 50 ul
EUR 223

CDC5L Antibody
AF7563 200ul
EUR 376
Description: CDC5L Antibody detects endogenous levels of CDC5L.

CDC5L antibody
70R-4924 50 ug
EUR 467
Description: Rabbit polyclonal CDC5L antibody

CDC5L Antibody
ABD13040 100 ug
EUR 438

CDC5L Antibody
ABD7400 100 ug
EUR 438

CDC5L Antibody
49288-100ul 100ul
EUR 333

CDC5L Antibody
49288-50ul 50ul
EUR 239

CDC5L antibody
10R-1324 100 ug
EUR 512
Description: Mouse monoclonal CDC5L antibody

CDC5L Antibody
32911-100ul 100ul
EUR 252

CDC5L antibody
70R-16309 50 ul
EUR 435
Description: Rabbit polyclonal CDC5L antibody

CDC5L Antibody
DF7400 200ul
EUR 304
Description: CDC5L Antibody detects endogenous levels of total CDC5L.

CDC5L Antibody
1-CSB-PA005021GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CDC5L. Recognizes CDC5L from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CDC5L Antibody
1-CSB-PA478063
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDC5L. Recognizes CDC5L from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

CDC5L Antibody
1-CSB-PA858712ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CDC5L. Recognizes CDC5L from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

CDC5L Antibody
1-CSB-PA858712ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CDC5L. Recognizes CDC5L from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CDC5L Antibody
1-CSB-PA218975
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDC5L. Recognizes CDC5L from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CDC5L Antibody
1-CSB-PA080082
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CDC5L. Recognizes CDC5L from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

CDC5L (Phospho-Tyr232) Polyclonal Conjugated Antibody
C12928 100ul
EUR 397

CDC5L Conjugated Antibody
C49288 100ul
EUR 397

CDC5L Conjugated Antibody
C32911 100ul
EUR 397

anti- CDC5L antibody
FNab01535 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:10 - 1:100
  • Immunogen: CDC5 cell division cycle 5-like (S. pombe)
  • Uniprot ID: Q99459
  • Gene ID: 988
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against CDC5L

Anti-CDC5L antibody
PAab01535 100 ug
EUR 355

Anti-CDC5L Antibody
PA2123 100ug/vial
EUR 294

Anti-Cdc5L antibody
STJ92180 200 µl
EUR 197
Description: Rabbit polyclonal to Cdc5L.

Anti-CDC5L antibody
STJ27506 100 µl
EUR 277
Description: The protein encoded by this gene shares a significant similarity with Schizosaccharomyces pombe cdc5 gene product, which is a cell cycle regulator important for G2/M transition. This protein has been demonstrated to act as a positive regulator of cell cycle G2/M progression. It was also found to be an essential component of a non-snRNA spliceosome, which contains at least five additional protein factors and is required for the second catalytic step of pre-mRNA splicing.

Cdc5l/ Rat Cdc5l ELISA Kit
ELI-50834r 96 Tests
EUR 886

CDC5L siRNA
20-abx900944
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDC5L siRNA
20-abx911166
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDC5L siRNA
20-abx911167
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CDC5L
YF-PA23406 50 ul
EUR 334
Description: Mouse polyclonal to CDC5L

Rabbit Anti-CDC5L monoclonal antibody, clone KK102-16
CABT-L849 100 ul
EUR 777

Phospho-CDC5L(Tyr232) Antibody
AF7063 200ul
EUR 376
Description: Phospho-CDC5L(Tyr232) Antibody detects endogenous levels of CDC5L only when phosphorylated at Tyr232.

CDC5L (Phospho-Tyr232) Antibody
12928-100ul 100ul
EUR 252

CDC5L (Phospho-Tyr232) Antibody
12928-50ul 50ul
EUR 187

CDC5L Blocking Peptide
AF7563-BP 1mg
EUR 195

CDC5L Blocking Peptide
33R-5034 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CDC5L antibody, catalog no. 70R-4924

CDC5L cloning plasmid
CSB-CL858712HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2409
  • Sequence: atgcctcgaattatgatcaaggggggcgtatggaggaataccgaggatgaaattctgaaagcagcggtaatgaaatatgggaaaaatcagtggtctaggattgcctcattgctgcatagaaaatcagcaaagcagtgcaaagccagatggtatgaatggctggatccaagcatta
  • Show more
Description: A cloning plasmid for the CDC5L gene.

CDC5L Blocking Peptide
DF7400-BP 1mg
EUR 195

Anti-CDC5L (3C12)
YF-MA12357 100 ug
EUR 363
Description: Mouse monoclonal to CDC5L

Mouse CDC5L shRNA Plasmid
20-abx977464
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat CDC5L shRNA Plasmid
20-abx987028
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CDC5L ELISA KIT|Human
EF008554 96 Tests
EUR 689

Human CDC5L shRNA Plasmid
20-abx950703
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CDC5L Recombinant Protein (Human)
RP006532 100 ug Ask for price

pCMV-Myc-CDC5L Plasmid
PVTB00666-2a 2 ug
EUR 356

CDC5L Recombinant Protein (Rat)
RP194162 100 ug Ask for price

CDC5L Recombinant Protein (Mouse)
RP122894 100 ug Ask for price

Cell Division Cycle 5 Like (CDC5L) Antibody
20-abx111507
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cell Division Cycle 5 Like (CDC5L) Antibody
20-abx004259
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cell Division Cycle 5 Like (CDC5L) Antibody
20-abx320245
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cell Division Cycle 5 Like (CDC5L) Antibody
20-abx322322
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cell Division Cycle 5 Like (CDC5L) Antibody
20-abx326676
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cell Division Cycle 5 Like (CDC5L) Antibody
20-abx214833
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cell Division Cycle 5 Like (CDC5L) Antibody
20-abx241486
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cell Division Cycle 5 Like (CDC5L) Antibody
abx231535-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Phospho-CDC5L(Tyr232) Blocking Peptide
AF7063-BP 1mg
EUR 195

CDC5L ORF Vector (Human) (pORF)
ORF002178 1.0 ug DNA
EUR 95

Cdc5l ORF Vector (Mouse) (pORF)
ORF040966 1.0 ug DNA
EUR 506

Cdc5l ORF Vector (Rat) (pORF)
ORF064722 1.0 ug DNA
EUR 506

Rabbit Cell division cycle 5 like protein(CDC5L) ELISA kit
E04C1523-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle 5 like protein(CDC5L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cell division cycle 5 like protein(CDC5L) ELISA kit
E04C1523-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle 5 like protein(CDC5L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cell division cycle 5 like protein(CDC5L) ELISA kit
E04C1523-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle 5 like protein(CDC5L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CDC5L sgRNA CRISPR Lentivector set (Human)
K0409401 3 x 1.0 ug
EUR 339

Cdc5l sgRNA CRISPR Lentivector set (Mouse)
K4474901 3 x 1.0 ug
EUR 339

Cdc5l sgRNA CRISPR Lentivector set (Rat)
K6998501 3 x 1.0 ug
EUR 339

CDC5L sgRNA CRISPR Lentivector (Human) (Target 1)
K0409402 1.0 ug DNA
EUR 154

CDC5L sgRNA CRISPR Lentivector (Human) (Target 2)
K0409403 1.0 ug DNA
EUR 154

CDC5L sgRNA CRISPR Lentivector (Human) (Target 3)
K0409404 1.0 ug DNA
EUR 154

Cdc5l sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4474902 1.0 ug DNA
EUR 154

Cdc5l sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4474903 1.0 ug DNA
EUR 154

Cdc5l sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4474904 1.0 ug DNA
EUR 154

Cdc5l sgRNA CRISPR Lentivector (Rat) (Target 1)
K6998502 1.0 ug DNA
EUR 154

Cdc5l sgRNA CRISPR Lentivector (Rat) (Target 2)
K6998503 1.0 ug DNA
EUR 154

Cdc5l sgRNA CRISPR Lentivector (Rat) (Target 3)
K6998504 1.0 ug DNA
EUR 154

CDC5L Protein Vector (Human) (pPB-C-His)
PV008709 500 ng
EUR 329

CDC5L Protein Vector (Human) (pPB-N-His)
PV008710 500 ng
EUR 329

CDC5L Protein Vector (Human) (pPM-C-HA)
PV008711 500 ng
EUR 329

CDC5L Protein Vector (Human) (pPM-C-His)
PV008712 500 ng
EUR 329

CDC5L Protein Vector (Rat) (pPB-C-His)
PV258886 500 ng
EUR 1166

CDC5L Protein Vector (Rat) (pPB-N-His)
PV258887 500 ng
EUR 1166

CDC5L Protein Vector (Rat) (pPM-C-HA)
PV258888 500 ng
EUR 1166

CDC5L Protein Vector (Rat) (pPM-C-His)
PV258889 500 ng
EUR 1166

CDC5L Protein Vector (Mouse) (pPB-C-His)
PV163862 500 ng
EUR 1065

CDC5L Protein Vector (Mouse) (pPB-N-His)
PV163863 500 ng
EUR 1065

CDC5L Protein Vector (Mouse) (pPM-C-HA)
PV163864 500 ng
EUR 1065

CDC5L Protein Vector (Mouse) (pPM-C-His)
PV163865 500 ng
EUR 1065

Cdc5l 3'UTR Luciferase Stable Cell Line
TU202047 1.0 ml Ask for price

Cdc5l 3'UTR GFP Stable Cell Line
TU153574 1.0 ml Ask for price

CDC5L 3'UTR Luciferase Stable Cell Line
TU003960 1.0 ml
EUR 2333

Cdc5l 3'UTR Luciferase Stable Cell Line
TU103574 1.0 ml Ask for price

CDC5L 3'UTR GFP Stable Cell Line
TU053960 1.0 ml
EUR 2333

Cdc5l 3'UTR GFP Stable Cell Line
TU252047 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Cdc5L Rabbit Polyclonal Antibody