ZFP91 Rabbit Polyclonal Antibody

ZFP91 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

ZFP91 Polyclonal Antibody
ABP57548-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 401-450
  • Applications tips:
Description: A polyclonal antibody for detection of ZFP91 from Human, Mouse, Rat. This ZFP91 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 401-450
ZFP91 Polyclonal Antibody
ABP57548-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 401-450
  • Applications tips:
Description: A polyclonal antibody for detection of ZFP91 from Human, Mouse, Rat. This ZFP91 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 401-450
ZFP91 Polyclonal Antibody
ES8541-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ZFP91 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
ZFP91 Polyclonal Antibody
ES8541-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ZFP91 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
ZFP91 antibody
20R-1105 100 ug
EUR 377
Description: Rabbit polyclonal ZFP91 antibody
ZFP91 antibody
20R-1106 100 ug
EUR 377
Description: Rabbit polyclonal ZFP91 antibody
ZFP91 Antibody
42873-100ul 100ul
EUR 252
ZFP91 Antibody
1-CSB-PA504466
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against ZFP91. Recognizes ZFP91 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000
ZFP91 antibody
70R-8108 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ZFP91 antibody
ZFP91 Zinc Finger Protein (ZFP91) Antibody
abx027075-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
ZFP91 Zinc Finger Protein (ZFP91) Antibody
abx027075-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
ZFP91 Zinc Finger Protein (ZFP91) Antibody
abx122288-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
ZFP91 Zinc Finger Protein (ZFP91) Antibody
20-abx329784
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
ZFP91 Zinc Finger Protein (ZFP91) Antibody
abx224439-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
E3 Ubiquitin-Protein Ligase ZFP91 (ZFP91) Antibody
abx224324-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
Anti-ZFP91 Antibody
A11088 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ZFP91 Antibody (ZFP91) detection. Tested with WB in Human, Mouse, Rat.
ZFP91 Conjugated Antibody
C42873 100ul
EUR 397
Anti-ZFP91 antibody
STJ98654 200 µl
EUR 197
Description: Rabbit polyclonal to ZFP91.
ZFP91 siRNA
20-abx940433
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ZFP91 siRNA
20-abx940434
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ZFP91 Blocking Peptide
33R-7842 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZFP91 antibody, catalog no. 20R-1106
ZFP91 Blocking Peptide
33R-7291 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZFP91 antibody, catalog no. 20R-1105
ZFP91 cloning plasmid
CSB-CL842694HU-10ug 10ug
EUR 588
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1710
  • Sequence: atgccgggggagacggaagagccgagacccccggagcagcaggaccaggaagggggagaggcggccaaggcggctccggaggagccccaacaacggccccctgaggcgatcgcggcggcgcctgcagggaccactagcagccgcgtgctgaggggaggtcgggaccgaggccggg
  • Show more
Description: A cloning plasmid for the ZFP91 gene.
Mouse E3 ubiquitin- protein ligase ZFP91, Zfp91 ELISA KIT
ELI-14759m 96 Tests
EUR 865
Human E3 ubiquitin- protein ligase ZFP91, ZFP91 ELISA KIT
ELI-17992h 96 Tests
EUR 824
Mouse ZFP91 shRNA Plasmid
20-abx980034
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human ZFP91 shRNA Plasmid
20-abx962924
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ZFP91 Recombinant Protein (Rat)
RP238625 100 ug Ask for price
ZFP91 Recombinant Protein (Human)
RP035392 100 ug Ask for price
ZFP91 Recombinant Protein (Mouse)
RP187841 100 ug Ask for price
Zfp91 ORF Vector (Mouse) (pORF)
ORF062615 1.0 ug DNA
EUR 506
Zfp91 ORF Vector (Rat) (pORF)
ORF079543 1.0 ug DNA
EUR 506
ZFP91 ORF Vector (Human) (pORF)
ORF011798 1.0 ug DNA
EUR 95
ZFP91-CNTF Recombinant Protein (Human)
RP108392 100 ug Ask for price
Zfp91 sgRNA CRISPR Lentivector set (Rat)
K7323601 3 x 1.0 ug
EUR 339
ZFP91 sgRNA CRISPR Lentivector set (Human)
K2674301 3 x 1.0 ug
EUR 339
Zfp91 sgRNA CRISPR Lentivector set (Mouse)
K4013301 3 x 1.0 ug
EUR 339
ZFP91-CNTF ORF Vector (Human) (pORF)
ORF036132 1.0 ug DNA Ask for price
Zfp91 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7323602 1.0 ug DNA
EUR 154
Zfp91 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7323603 1.0 ug DNA
EUR 154
Zfp91 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7323604 1.0 ug DNA
EUR 154
ZFP91 sgRNA CRISPR Lentivector (Human) (Target 1)
K2674302 1.0 ug DNA
EUR 154
ZFP91 sgRNA CRISPR Lentivector (Human) (Target 2)
K2674303 1.0 ug DNA
EUR 154
ZFP91 sgRNA CRISPR Lentivector (Human) (Target 3)
K2674304 1.0 ug DNA
EUR 154
Zfp91 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4013302 1.0 ug DNA
EUR 154
Zfp91 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4013303 1.0 ug DNA
EUR 154
Zfp91 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4013304 1.0 ug DNA
EUR 154
Recombinant human E3 ubiquitin-protein ligase ZFP91
P2644 100ug Ask for price
  • Uniprot ID: Q96JP5
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human E3 ubiquitin-protein ligase ZFP91
ZFP91 Protein Vector (Mouse) (pPB-C-His)
PV250458 500 ng
EUR 603
ZFP91 Protein Vector (Mouse) (pPB-N-His)
PV250459 500 ng
EUR 603

ZFP91 Rabbit Polyclonal Antibody