ZFP91 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

ZFP91 Polyclonal Antibody
ES8541-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ZFP91 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ZFP91 Polyclonal Antibody
ABP57548-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthetic peptide from human protein at AA range: 401-450 Applications tips:
Description: A polyclonal antibody for detection of ZFP91 from Human, Mouse, Rat. This ZFP91 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 401-450

ZFP91 Polyclonal Antibody
ABP57548-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthetic peptide from human protein at AA range: 401-450 Applications tips:
Description: A polyclonal antibody for detection of ZFP91 from Human, Mouse, Rat. This ZFP91 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 401-450

ZFP91 Polyclonal Antibody
ABP57548-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthetic peptide from human protein at AA range: 401-450 Applications tips:
Description: A polyclonal antibody for detection of ZFP91 from Human, Mouse, Rat. This ZFP91 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 401-450

ZFP91 antibody
70R-8108	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal ZFP91 antibody

ZFP91 Antibody
42873-100ul	SAB	100ul	EUR 252

ZFP91 antibody
20R-1105	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal ZFP91 antibody

ZFP91 antibody
20R-1106	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal ZFP91 antibody

ZFP91 Antibody
1-CSB-PA504466	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against ZFP91. Recognizes ZFP91 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000

ZFP91 Zinc Finger Protein (ZFP91) Antibody
abx122288-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

ZFP91 Zinc Finger Protein (ZFP91) Antibody
abx027075-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

ZFP91 Zinc Finger Protein (ZFP91) Antibody
abx027075-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

ZFP91 Zinc Finger Protein (ZFP91) Antibody
20-abx329784	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

ZFP91 Zinc Finger Protein (ZFP91) Antibody
abx224439-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase ZFP91 (ZFP91) Antibody
abx224324-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

ZFP91 Conjugated Antibody
C42873	SAB	100ul	EUR 397

Anti-ZFP91 Antibody
A11088	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for ZFP91 Antibody (ZFP91) detection. Tested with WB in Human, Mouse, Rat.

Anti-ZFP91 antibody
STJ98654	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to ZFP91.

ZFP91 siRNA
20-abx940433	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ZFP91 siRNA
20-abx940434	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ZFP91 Blocking Peptide
33R-7291	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZFP91 antibody, catalog no. 20R-1105

ZFP91 Blocking Peptide
33R-7842	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZFP91 antibody, catalog no. 20R-1106

ZFP91 cloning plasmid
CSB-CL842694HU-10ug	Cusabio	10ug	EUR 588
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1710 Sequence: atgccgggggagacggaagagccgagacccccggagcagcaggaccaggaagggggagaggcggccaaggcggctccggaggagccccaacaacggccccctgaggcgatcgcggcggcgcctgcagggaccactagcagccgcgtgctgaggggaggtcgggaccgaggccggg Show more
Description: A cloning plasmid for the ZFP91 gene.

Human E3 ubiquitin- protein ligase ZFP91, ZFP91 ELISA KIT
ELI-17992h	Lifescience Market	96 Tests	EUR 824

Mouse E3 ubiquitin- protein ligase ZFP91, Zfp91 ELISA KIT
ELI-14759m	Lifescience Market	96 Tests	EUR 865

Mouse ZFP91 shRNA Plasmid
20-abx980034	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ZFP91 shRNA Plasmid
20-abx962924	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ZFP91 Recombinant Protein (Human)
RP035392	ABM	100 ug	Ask for price

ZFP91 Recombinant Protein (Rat)
RP238625	ABM	100 ug	Ask for price

ZFP91 Recombinant Protein (Mouse)
RP187841	ABM	100 ug	Ask for price

Zfp91 ORF Vector (Rat) (pORF)
ORF079543	ABM	1.0 ug DNA	EUR 506

ZFP91 ORF Vector (Human) (pORF)
ORF011798	ABM	1.0 ug DNA	EUR 95

Zfp91 ORF Vector (Mouse) (pORF)
ORF062615	ABM	1.0 ug DNA	EUR 506

ZFP91-CNTF Recombinant Protein (Human)
RP108392	ABM	100 ug	Ask for price

ZFP91 sgRNA CRISPR Lentivector set (Human)
K2674301	ABM	3 x 1.0 ug	EUR 339

Zfp91 sgRNA CRISPR Lentivector set (Mouse)
K4013301	ABM	3 x 1.0 ug	EUR 339

Zfp91 sgRNA CRISPR Lentivector set (Rat)
K7323601	ABM	3 x 1.0 ug	EUR 339

ZFP91-CNTF ORF Vector (Human) (pORF)
ORF036132	ABM	1.0 ug DNA	Ask for price

ZFP91 sgRNA CRISPR Lentivector (Human) (Target 1)
K2674302	ABM	1.0 ug DNA	EUR 154

ZFP91 sgRNA CRISPR Lentivector (Human) (Target 2)
K2674303	ABM	1.0 ug DNA	EUR 154

ZFP91 sgRNA CRISPR Lentivector (Human) (Target 3)
K2674304	ABM	1.0 ug DNA	EUR 154

Zfp91 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4013302	ABM	1.0 ug DNA	EUR 154

Zfp91 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4013303	ABM	1.0 ug DNA	EUR 154

Zfp91 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4013304	ABM	1.0 ug DNA	EUR 154

Zfp91 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7323602	ABM	1.0 ug DNA	EUR 154

Zfp91 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7323603	ABM	1.0 ug DNA	EUR 154

Zfp91 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7323604	ABM	1.0 ug DNA	EUR 154

Recombinant human E3 ubiquitin-protein ligase ZFP91
P2644	FN Test	100ug	Ask for price
Uniprot ID: Q96JP5 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human E3 ubiquitin-protein ligase ZFP91

ZFP91 Protein Vector (Human) (pPB-C-His)
PV047189	ABM	500 ng	EUR 329

ZFP91 Protein Vector (Human) (pPB-N-His)
PV047190	ABM	500 ng	EUR 329

ZFP91 Rabbit Polyclonal Antibody