CXCR4 Rabbit Polyclonal Antibody

CXCR4 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

Polyclonal CXCR4 Antibody
APG02836G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXCR4 . This antibody is tested and proven to work in the following applications:
Polyclonal CXCR4 Antibody
APR00287G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXCR4 . This antibody is tested and proven to work in the following applications:
CXCR4 Polyclonal Antibody
EA281-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CXCR4 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC
CXCR4 Polyclonal Antibody
EA281-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CXCR4 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC
CXCR4 Polyclonal Antibody
A50165 100 µg
EUR 570.55
Description: kits suitable for this type of research
CXCR4 Polyclonal Antibody
ABP57317-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CXCR4 from Human, Mouse, Rat. This CXCR4 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide
CXCR4 Polyclonal Antibody
ABP57317-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CXCR4 from Human, Mouse, Rat. This CXCR4 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide
CXCR4 Polyclonal Antibody
ABP57317-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CXCR4 from Human, Mouse, Rat. This CXCR4 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide
CXCR4 Polyclonal Antibody
ES8310-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CXCR4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
CXCR4 Polyclonal Antibody
ES8310-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CXCR4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
CXCR4 Rabbit pAb
A13672-100ul 100 ul
EUR 308
CXCR4 Rabbit pAb
A13672-200ul 200 ul
EUR 459
CXCR4 Rabbit pAb
A13672-20ul 20 ul
EUR 183
CXCR4 Rabbit pAb
A13672-50ul 50 ul
EUR 223
CXCR4 Rabbit pAb
A12534-100ul 100 ul
EUR 308
CXCR4 Rabbit pAb
A12534-200ul 200 ul
EUR 459
CXCR4 Rabbit pAb
A12534-20ul 20 ul
EUR 183
CXCR4 Rabbit pAb
A12534-50ul 50 ul
EUR 223
CXCR4 Rabbit pAb
A1303-100ul 100 ul
EUR 308
CXCR4 Rabbit pAb
A1303-200ul 200 ul
EUR 459
CXCR4 Rabbit pAb
A1303-20ul 20 ul
EUR 183
CXCR4 Rabbit pAb
A1303-50ul 50 ul
EUR 223
CXCR4 Rabbit mAb
A19035-100ul 100 ul
EUR 410
CXCR4 Rabbit mAb
A19035-200ul 200 ul
EUR 571
CXCR4 Rabbit mAb
A19035-20ul 20 ul
EUR 221
CXCR4 Rabbit mAb
A19035-50ul 50 ul
EUR 287
CXCR4 Rabbit pAb
A15112-100ul 100 ul
EUR 308
CXCR4 Rabbit pAb
A15112-200ul 200 ul
EUR 459
CXCR4 Rabbit pAb
A15112-20ul 20 ul
EUR 183
CXCR4 Rabbit pAb
A15112-50ul 50 ul
EUR 223
Polyclonal CXCR4 (extracellular) Antibody
APG02835G 0.05ml
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXCR4 (extracellular) . This antibody is tested and proven to work in the following applications:
Polyclonal CXCR4 Antibody (N-term)
APC00089G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXCR4 (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal CXCR4 Antibody (aa13-38)
APG02837G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CXCR4 (aa13-38). This antibody is tested and proven to work in the following applications:
Polyclonal CXCR4 Antibody (aa14-40)
APG02838G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CXCR4 (aa14-40). This antibody is tested and proven to work in the following applications:
Polyclonal CXCR4 Antibody (Cytoplasmic Domain)
APG02839G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXCR4 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:
Polyclonal CXCR4 Antibody (Cytoplasmic Domain)
APG02840G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXCR4 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:
Polyclonal CXCR4 Antibody (N-Terminus)
APG02841G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXCR4 (N-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal CXCR4 Antibody (N-Terminus)
APG02842G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXCR4 (N-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal CXCR4 Antibody (N-term)
AMM08772G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXCR4 (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal CXCR4 Antibody(N-term)
APR10833G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXCR4 (N-term). This antibody is tested and proven to work in the following applications:
CXCR4 Polyclonal Antibody, HRP Conjugated
A50166 100 µg
EUR 570.55
Description: fast delivery possible
CXCR4 Polyclonal Antibody, FITC Conjugated
A50167 100 µg
EUR 570.55
Description: reagents widely cited
CXCR4 Polyclonal Antibody, Biotin Conjugated
A50168 100 µg
EUR 570.55
Description: Ask the seller for details
CXCR4 Antibody
24002-100ul 100ul
EUR 390
CXCR4 Antibody
24003-100ul 100ul
EUR 390
CXCR4 antibody
20R-1808 100 ug
EUR 673
Description: Rabbit polyclonal CXCR4 antibody
CXCR4 antibody
20R-CG008 200 ug
EUR 543
Description: Goat polyclonal CXCR4 antibody
CXCR4 antibody
70R-16688 50 ul
EUR 435
Description: Rabbit polyclonal CXCR4 antibody
CXCR4 antibody
70R-12301 100 ug
EUR 447
Description: Rabbit polyclonal CXCR4 antibody
CXCR4 antibody
70R-12359 100 ug
EUR 436
Description: Rabbit polyclonal CXCR4 antibody
CXCR4 antibody
70R-30897 100 ug
EUR 327
Description: Rabbit polyclonal CXCR4 antibody
CXCR4 antibody
70R-13830 100 ug
EUR 322
Description: Affinity purified Goat polyclonal CXCR4 antibody
CXCR4 Antibody
36326-100ul 100ul
EUR 252
CXCR4 Antibody
5224-100
EUR 338
CXCR4 Antibody
5541-100
EUR 338
CXCR4 Antibody
5541-30T
EUR 146
CXCR4 Antibody
1-CSB-PA006254GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CXCR4. Recognizes CXCR4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
CXCR4 Antibody
1-CSB-PA006254YA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCR4. Recognizes CXCR4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200
CXCR4 Antibody
1-CSB-PA002588
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CXCR4. Recognizes CXCR4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/40000
CXCR4 Antibody
1-CSB-PA099227
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CXCR4. Recognizes CXCR4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
CXCR4 Antibody
1-CSB-PA996565
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CXCR4. Recognizes CXCR4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100
CXCR4 Antibody
DF8046 200ul
EUR 304
Description: CXCR4 Antibody detects endogenous levels of total CXCR4.
CXCR4 Antibody
1-CSB-PA250029
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CXCR4. Recognizes CXCR4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
CXCR4 Antibody
1-CSB-PA263860
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CXCR4. Recognizes CXCR4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
CXCR4 antibody
70R-CR011 200 ug
EUR 435
Description: Affinity purified Rabbit polyclonal CXCR4 antibody
CXCR4 antibody
70R-7849 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CXCR4 antibody
CXCR4 Antibody
abx140472-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.
CXCR4 Antibody
AF5279 200ul
EUR 304
Description: CXCR4 Antibody detects endogenous levels of total CXCR4.
CXCR4 Antibody
AF7829 200ul
EUR 376
Description: CXCR4 Antibody detects endogenous levels of CXCR4.
CXCR4 Antibody
ABD8046 100 ug
EUR 438
CXCR4 Antibody
ABF5279 100 ug
EUR 438
Human Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit
DLR-CXCR4-Hu-48T 48T
EUR 479
  • Should the Human Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chemokine C-X-C-Motif Receptor 4 (CXCR4) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit
DLR-CXCR4-Hu-96T 96T
EUR 621
  • Should the Human Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chemokine C-X-C-Motif Receptor 4 (CXCR4) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit
DLR-CXCR4-Mu-48T 48T
EUR 489
  • Should the Mouse Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Chemokine C-X-C-Motif Receptor 4 (CXCR4) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit
DLR-CXCR4-Mu-96T 96T
EUR 635
  • Should the Mouse Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Chemokine C-X-C-Motif Receptor 4 (CXCR4) in samples from tissue homogenates, cell lysates or other biological fluids.
Porcine Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit
DLR-CXCR4-p-48T 48T
EUR 547
  • Should the Porcine Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Chemokine C-X-C-Motif Receptor 4 (CXCR4) in samples from tissue homogenates or other biological fluids.
Porcine Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit
DLR-CXCR4-p-96T 96T
EUR 715
  • Should the Porcine Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Chemokine C-X-C-Motif Receptor 4 (CXCR4) in samples from tissue homogenates or other biological fluids.
Human Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit
RDR-CXCR4-Hu-48Tests 48 Tests
EUR 500
Human Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit
RDR-CXCR4-Hu-96Tests 96 Tests
EUR 692
Mouse Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit
RDR-CXCR4-Mu-48Tests 48 Tests
EUR 511
Mouse Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit
RDR-CXCR4-Mu-96Tests 96 Tests
EUR 709
Porcine Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit
RDR-CXCR4-p-48Tests 48 Tests
EUR 580
Porcine Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit
RDR-CXCR4-p-96Tests 96 Tests
EUR 807
Human Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit
RD-CXCR4-Hu-48Tests 48 Tests
EUR 478
Human Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit
RD-CXCR4-Hu-96Tests 96 Tests
EUR 662
Mouse Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit
RD-CXCR4-Mu-48Tests 48 Tests
EUR 489
Mouse Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit
RD-CXCR4-Mu-96Tests 96 Tests
EUR 677
Porcine Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit
RD-CXCR4-p-48Tests 48 Tests
EUR 555
Porcine Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit
RD-CXCR4-p-96Tests 96 Tests
EUR 771
Polyclonal CXCR4 antibody - N-terminal region
APG02843G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXCR4 - N-terminal region. This antibody is tested and proven to work in the following applications:
CXCR4
MO15022 100 ug
EUR 474
CXCR4-Lo Antibody
24624-100ul 100ul
EUR 390
Anti-CXCR4 Antibody
A00031-2 100ug/vial
EUR 294
CXCR4 antibody (Ser339)
70R-33523 100 ug
EUR 327
Description: Rabbit polyclonal CXCR4 antibody (Ser339)
CXCR4 Conjugated Antibody
C36326 100ul
EUR 397
anti- CXCR4 antibody
FNab02102 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: chemokine (C-X-C motif) receptor 4
  • Uniprot ID: P61073
  • Gene ID: 7852
  • Research Area: Signal Transduction, Immunology, Developmental biology, Neuroscience, Stem Cells
Description: Antibody raised against CXCR4
anti- CXCR4 antibody
FNab02103 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • Immunogen: chemokine(C-X-C motif) receptor 4
  • Uniprot ID: P61073
  • Gene ID: 7852
  • Research Area: Signal Transduction, Immunology, Developmental biology, Neuroscience, Stem Cells
Description: Antibody raised against CXCR4
Anti-CXCR4 Antibody
PA1237 100ug/vial
EUR 334
Anti-CXCR4 Antibody
PA2081 100ug/vial
EUR 294
Anti-CXCR4 antibody
PAab02102 100 ug
EUR 355
Anti-CXCR4 antibody
STJ114408 100 µl
EUR 277
Description: This gene encodes a CXC chemokine receptor specific for stromal cell-derived factor-1. The protein has 7 transmembrane regions and is located on the cell surface. It acts with the CD4 protein to support HIV entry into cells and is also highly expressed in breast cancer cells. Mutations in this gene have been associated with WHIM (warts, hypogammaglobulinemia, infections, and myelokathexis) syndrome. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.
Anti-CXCR4 antibody
STJ115628 100 µl
EUR 277
Description: This gene encodes a CXC chemokine receptor specific for stromal cell-derived factor-1. The protein has 7 transmembrane regions and is located on the cell surface. It acts with the CD4 protein to support HIV entry into cells and is also highly expressed in breast cancer cells. Mutations in this gene have been associated with WHIM (warts, hypogammaglobulinemia, infections, and myelokathexis) syndrome. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.
Anti-CXCR4 antibody
STJ117306 100 µl
EUR 277
Description: This gene encodes a CXC chemokine receptor specific for stromal cell-derived factor-1. The protein has 7 transmembrane regions and is located on the cell surface. It acts with the CD4 protein to support HIV entry into cells and is also highly expressed in breast cancer cells. Mutations in this gene have been associated with WHIM (warts, hypogammaglobulinemia, infections, and myelokathexis) syndrome. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.
Anti-CXCR4 Antibody
STJ500660 100 µg
EUR 476
Anti-CXCR4 Antibody
STJ193180 200 µl
EUR 197
Anti-CXCR4 antibody
STJ23304 100 µl
EUR 277
Description: This gene encodes a CXC chemokine receptor specific for stromal cell-derived factor-1. The protein has 7 transmembrane regions and is located on the cell surface. It acts with the CD4 protein to support HIV entry into cells and is also highly expressed in breast cancer cells. Mutations in this gene have been associated with WHIM (warts, hypogammaglobulinemia, infections, and myelokathexis) syndrome. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.
Anti-CXCR4 antibody
STJ97564 200 µl
EUR 197
Description: Rabbit polyclonal to CXCR4 (A220).
CXCR4 siRNA
20-abx913265
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CXCR4 siRNA
20-abx913266
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
pENTR223- CXCR4
PVT10004 2 ug
EUR 266
anti-CXCR4
YF-PA15478 100 ug
EUR 403
Description: Rabbit polyclonal to CXCR4
CXCR4 Antibody, HRP conjugated
1-CSB-PA006254YB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCR4. Recognizes CXCR4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
CXCR4 Antibody, FITC conjugated
1-CSB-PA006254YC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCR4. Recognizes CXCR4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
CXCR4 Antibody, Biotin conjugated
1-CSB-PA006254YD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCR4. Recognizes CXCR4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Phospho-CXCR4 (S339) Antibody
1-CSB-PA060127
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-CXCR4 (S339). Recognizes Phospho-CXCR4 (S339) from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000
Anti-CXCR4 Monoclonal Antibody
M00031 100ug
EUR 397
Description: Rabbit Monoclonal CXCR4 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse.
Antibody for Human CXCR4
SPC-1293D 0.1ml
EUR 314
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is unconjugated.
Antibody for Human CXCR4
SPC-1293D-A390 0.1ml
EUR 361
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to ATTO 390.
Antibody for Human CXCR4
SPC-1293D-A488 0.1ml
EUR 360
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to ATTO 488.
Antibody for Human CXCR4
SPC-1293D-A565 0.1ml
EUR 360
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to ATTO 565.
Antibody for Human CXCR4
SPC-1293D-A594 0.1ml
EUR 360
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to ATTO 594.
Antibody for Human CXCR4
SPC-1293D-A633 0.1ml
EUR 360
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to ATTO 633.
Antibody for Human CXCR4
SPC-1293D-A655 0.1ml
EUR 360
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to ATTO 655.
Antibody for Human CXCR4
SPC-1293D-A680 0.1ml
EUR 360
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to ATTO 680.
Antibody for Human CXCR4
SPC-1293D-A700 0.1ml
EUR 360
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to ATTO 700.
Antibody for Human CXCR4
SPC-1293D-ALP 0.1ml
EUR 355
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to Alkaline Phosphatase.
Antibody for Human CXCR4
SPC-1293D-APC 0.1ml
EUR 359
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to APC .
Antibody for Human CXCR4
SPC-1293D-APCCY7 0.1ml
EUR 432
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to APC/Cy7.
Antibody for Human CXCR4
SPC-1293D-BI 0.1ml
EUR 357
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to Biotin.
Antibody for Human CXCR4
SPC-1293D-DY350 0.1ml
EUR 436
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to Dylight 350.
Antibody for Human CXCR4
SPC-1293D-DY405 0.1ml
EUR 412
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to Dylight 405.
Antibody for Human CXCR4
SPC-1293D-DY488 0.1ml
EUR 393
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to Dylight 488.
Antibody for Human CXCR4
SPC-1293D-DY594 0.1ml
EUR 397
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to Dylight 594.
Antibody for Human CXCR4
SPC-1293D-DY633 0.1ml
EUR 387
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to Dylight 633.
Antibody for Human CXCR4
SPC-1293D-FITC 0.1ml
EUR 353
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to FITC.
Antibody for Human CXCR4
SPC-1293D-HRP 0.1ml
EUR 349
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to HRP.
Antibody for Human CXCR4
SPC-1293D-P594 0.1ml
EUR 367
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to PE/ATTO 594.
Antibody for Human CXCR4
SPC-1293D-PCP 0.1ml
EUR 359
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to PerCP.
Antibody for Human CXCR4
SPC-1293D-RPE 0.1ml
EUR 358
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to RPE .
Antibody for Human CXCR4
SPC-1293D-STR 0.1ml
EUR 359
  • C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
  • Show more
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to Streptavidin.
Anti-CXCR4 Antibody (Biotin)
STJ500661 100 µg
EUR 586
Anti-CXCR4 Antibody (FITC)
STJ500662 100 µg
EUR 586
CXCR4 (Phospho-Ser338/339) Antibody
13178-100ul 100ul
EUR 252
CXCR4 (Phospho-Ser338/339) Antibody
13178-50ul 50ul
EUR 187
Phospho-CXCR4 (Ser338/339) Antibody
AF7329 200ul
EUR 376
Description: Phospho-CXCR4 (Ser338/339) Antibody detects endogenous levels of CXCR4 only when phosphorylated at Ser338/339.
CXCR4 Blocking Peptide
33R-10577 50 ug
EUR 349
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CXCR4 antibody, catalog no. 20R-1808
CXCR4 Blocking Peptide
33R-11046 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CXCR4 antibody, catalog no. 70R-12359
CXCR4 Blocking Peptide
33R-5918 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CXCR4 antibody, catalog no. 70R-7849
CXCR4 Blocking Peptide
5541BP-50
EUR 153
CXCR4 Blocking Peptide
DF8046-BP 1mg
EUR 195
CXCR4 Blocking Peptide
AF5279-BP 1mg
EUR 195
CXCR4 Blocking Peptide
AF7829-BP 1mg
EUR 195
CXCR4 cloning plasmid
CSB-CL006254HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1059
  • Sequence: atggaggggatcagtatatacacttcagataactacaccgaggaaatgggctcaggggactatgactccatgaaggaaccctgtttccgtgaagaaaatgctaatttcaataaaatcttcctgcccaccatctactccatcatcttcttaactggcattgtgggcaatggattgg
  • Show more
Description: A cloning plasmid for the CXCR4 gene.
CXCR4-Phycoerythrin Labeled
FC15004 100 Tests
EUR 448
Anti-CXCR4 (2H5)
YF-MA16238 100 ug
EUR 363
Description: Mouse monoclonal to CXCR4
Anti-CXCR4 (1F8)
YF-MA16239 100 ug
EUR 363
Description: Mouse monoclonal to CXCR4
Anti-CXCR4 (1F8)
YF-MA16240 200 ul
EUR 363
Description: Mouse monoclonal to CXCR4
Anti-CXCR4 (2A9)
YF-MA16241 100 ug
EUR 363
Description: Mouse monoclonal to CXCR4
Anti-CXCR4 (2G9)
YF-MA16242 100 ug
EUR 363
Description: Mouse monoclonal to CXCR4
CXCR4 (Phospho-Ser338/339) Conjugated Antibody
C13178 100ul
EUR 397
Human CXCR4 ELISA Kit
ELA-E2170h 96 Tests
EUR 824
CXCR4 ELISA KIT|Human
EF006211 96 Tests
EUR 689
Anti-CXCR4-dasatinib ADC
ADC-W-520 1mg Ask for price
Description: This ADC product is comprised of an anti-CXCR4 monoclonal antibody conjugated via a linker to dasatinib

CXCR4 Rabbit Polyclonal Antibody