Atg9a Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

Polyclonal ATG9A Antibody
APG02065G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG9A . This antibody is tested and proven to work in the following applications:

Atg9a Polyclonal Antibody
ES8476-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Atg9a from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Atg9a Polyclonal Antibody
ES8476-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Atg9a from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Atg9a Polyclonal Antibody
ABP57483-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthetic Peptide of Atg9a Applications tips:
Description: A polyclonal antibody for detection of Atg9a from Human, Mouse, Rat. This Atg9a antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of Atg9a

Atg9a Polyclonal Antibody
ABP57483-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthetic Peptide of Atg9a Applications tips:
Description: A polyclonal antibody for detection of Atg9a from Human, Mouse, Rat. This Atg9a antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of Atg9a

Atg9a Polyclonal Antibody
ABP57483-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthetic Peptide of Atg9a Applications tips:
Description: A polyclonal antibody for detection of Atg9a from Human, Mouse, Rat. This Atg9a antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of Atg9a

ATG9A Rabbit pAb
A5571-100ul	Abclonal	100 ul	EUR 308

ATG9A Rabbit pAb
A5571-200ul	Abclonal	200 ul	EUR 459

ATG9A Rabbit pAb
A5571-20ul	Abclonal	20 ul	EUR 183

ATG9A Rabbit pAb
A5571-50ul	Abclonal	50 ul	EUR 223

ATG9A Rabbit pAb
A7994-100ul	Abclonal	100 ul	EUR 308

ATG9A Rabbit pAb
A7994-200ul	Abclonal	200 ul	EUR 459

ATG9A Rabbit pAb
A7994-20ul	Abclonal	20 ul	EUR 183

ATG9A Rabbit pAb
A7994-50ul	Abclonal	50 ul	EUR 223

Polyclonal ATG9A Antibody (Center)
APG02067G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG9A (Center). This antibody is tested and proven to work in the following applications:

Anti-ATG9A Rabbit Monoclonal Antibody
M03757	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal ATG9A Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Atg9a antibody
70R-9633	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Atg9a antibody

ATG9A antibody
70R-6415	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal ATG9A antibody

ATG9A Antibody
ABD2695	Lifescience Market	100 ug	EUR 438

ATG9A Antibody
ABD8034	Lifescience Market	100 ug	EUR 438

ATG9A Antibody
ABD8346	Lifescience Market	100 ug	EUR 438

ATG9A Antibody
36225-100ul	SAB	100ul	EUR 252

ATG9A Antibody
48988-100ul	SAB	100ul	EUR 333

ATG9A Antibody
48988-50ul	SAB	50ul	EUR 239

ATG9A Antibody
25202-100ul	SAB	100ul	EUR 390

ATG9A Antibody
DF8034	Affbiotech	200ul	EUR 304
Description: ATG9A Antibody detects endogenous levels of total ATG9A.

ATG9A Antibody
1-CSB-PA868793	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ATG9A. Recognizes ATG9A from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

ATG9A Antibody
DF2695	Affbiotech	200ul	EUR 304
Description: ATG9A antibody detects endogenous levels of total ATG9A.

ATG9A Antibody
1-CSB-PA773782ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ATG9A. Recognizes ATG9A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ATG9A Antibody
1-CSB-PA554014	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ATG9A. Recognizes ATG9A from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

Polyclonal ATG9A Antibody (C-Terminus)
APG02066G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG9A (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal ATG9A Antibody (C-term)
APR07027G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG9A (C-term). This antibody is tested and proven to work in the following applications:

ATG9A Conjugated Antibody
C48988	SAB	100ul	EUR 397

ATG9A Conjugated Antibody
C36225	SAB	100ul	EUR 397

Anti-Atg9a antibody
STJ98589	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Atg9a.

Anti-ATG9A antibody
STJ110301	St John's Laboratory	100 µl	EUR 277

Anti-ATG9A antibody
STJ13100025	St John's Laboratory	150 µl	EUR 427

Anti-ATG9A antibody
STJ117815	St John's Laboratory	100 µl	EUR 277

Atg9a/ Rat Atg9a ELISA Kit
ELI-49603r	Lifescience Market	96 Tests	EUR 886

ATG9A siRNA
20-abx900504	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ATG9A siRNA
20-abx908472	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ATG9A siRNA
20-abx908473	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Rabbit Anti-ATG9A monoclonal antibody, clone TD78-16
CABT-L711	Creative Diagnostics	100 ul	EUR 777

ATG9A recombinant monoclonal antibody
A5123	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human ATG9A for WB,ELISA

Atg9a Blocking Peptide
33R-1246	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LARGE antibody, catalog no. 70R-6856

ATG9A Blocking Peptide
33R-9437	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ATG9A antibody, catalog no. 70R-6415

ATG9A Blocking Peptide
DF8034-BP	Affbiotech	1mg	EUR 195

ATG9A Blocking Peptide
DF2695-BP	Affbiotech	1mg	EUR 195

ATG9A cloning plasmid
CSB-CL773782HU1-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1566 Sequence: atggtgaaccacagtcttcaccctactgaacccgtcaaggtcactctgccagacgcctttttgcctgctcaagtctgtagtgccaggattcaggaaaatggctcccttatcaccatcctggtcattgctggtgtcttctggatccaccggcttatcaagttcatctataacattt Show more
Description: A cloning plasmid for the ATG9A gene.

ATG9A cloning plasmid
CSB-CL773782HU2-10ug	Cusabio	10ug	EUR 553
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1587 Sequence: atggcgcagtttgacactgaataccagcgcctagaggcctcctatagtgattcacccccaggggaggaggacctgttggtgcacgtcgccgaggggagcaagtcaccttggcaccatattgaaaaccttgacctcttcttctctcgagtttataatctgcaccagaagaatggct Show more
Description: A cloning plasmid for the ATG9A gene.

Autophagy Related 9A (ATG9A) Antibody
20-abx007110	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody
abx030060-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody
abx030060-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody
abx030061-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody
abx030061-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody
20-abx320321	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody
abx412192-01mg	Abbexa	0.1 mg	EUR 537
Shipped within 1 week.

Autophagy Related 9A (ATG9A) Antibody
20-abx242486	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody
20-abx242504	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody
20-abx225051	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Rabbit Autophagy related protein 9A(ATG9A) ELISA kit
E04A1751-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Autophagy related protein 9A(ATG9A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Autophagy related protein 9A(ATG9A) ELISA kit
E04A1751-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Autophagy related protein 9A(ATG9A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Autophagy related protein 9A(ATG9A) ELISA kit
E04A1751-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Autophagy related protein 9A(ATG9A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ATG9A shRNA Plasmid
20-abx990528	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse ATG9A shRNA Plasmid
20-abx982782	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ATG9A shRNA Plasmid
20-abx962285	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pCMV-Flag-ATG9A Plasmid
PVTB01039-2a	Lifescience Market	2 ug	EUR 356

ATG9A ORF Vector (Human) (pORF)
ORF000742	ABM	1.0 ug DNA	EUR 95

ATG9A ORF Vector (Human) (pORF)
ORF000743	ABM	1.0 ug DNA	EUR 95

Atg9a ORF Vector (Mouse) (pORF)
ORF039266	ABM	1.0 ug DNA	EUR 506

Atg9a ORF Vector (Rat) (pORF)
ORF063780	ABM	1.0 ug DNA	EUR 506

pECMV-Atg9a-m-FLAG Plasmid
PVT15103	Lifescience Market	2 ug	EUR 325

ATG9A sgRNA CRISPR Lentivector set (Human)
K0142601	ABM	3 x 1.0 ug	EUR 339

Atg9a sgRNA CRISPR Lentivector set (Mouse)
K4301701	ABM	3 x 1.0 ug	EUR 339

Atg9a sgRNA CRISPR Lentivector set (Rat)
K7300301	ABM	3 x 1.0 ug	EUR 339

ATG9A sgRNA CRISPR Lentivector (Human) (Target 1)
K0142602	ABM	1.0 ug DNA	EUR 154

ATG9A sgRNA CRISPR Lentivector (Human) (Target 2)
K0142603	ABM	1.0 ug DNA	EUR 154

ATG9A sgRNA CRISPR Lentivector (Human) (Target 3)
K0142604	ABM	1.0 ug DNA	EUR 154

Atg9a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4301702	ABM	1.0 ug DNA	EUR 154

Atg9a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4301703	ABM	1.0 ug DNA	EUR 154

Atg9a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4301704	ABM	1.0 ug DNA	EUR 154

Atg9a sgRNA CRISPR Lentivector (Rat) (Target 1)
K7300302	ABM	1.0 ug DNA	EUR 154

Atg9a sgRNA CRISPR Lentivector (Rat) (Target 2)
K7300303	ABM	1.0 ug DNA	EUR 154

Atg9a sgRNA CRISPR Lentivector (Rat) (Target 3)
K7300304	ABM	1.0 ug DNA	EUR 154

ATG9A Protein Vector (Human) (pPB-C-His)
PV002965	ABM	500 ng	EUR 329

ATG9A Protein Vector (Human) (pPB-N-His)
PV002966	ABM	500 ng	EUR 329

ATG9A Protein Vector (Human) (pPM-C-HA)
PV002967	ABM	500 ng	EUR 329

ATG9A Protein Vector (Human) (pPM-C-His)
PV002968	ABM	500 ng	EUR 329

ATG9A Protein Vector (Human) (pPB-C-His)
PV002969	ABM	500 ng	EUR 329

ATG9A Protein Vector (Human) (pPB-N-His)
PV002970	ABM	500 ng	EUR 329

ATG9A Protein Vector (Human) (pPM-C-HA)
PV002971	ABM	500 ng	EUR 329

ATG9A Protein Vector (Human) (pPM-C-His)
PV002972	ABM	500 ng	EUR 329

pGEX-4T-1-ATG9A(670-839aa) Plasmid
PVTB01039-1a	Lifescience Market	2 ug	EUR 356

ATG9A Protein Vector (Human) (pPB-His-MBP)
PV324806	ABM	500 ng	EUR 329

ATG9A Protein Vector (Human) (pPB-His-GST)
PV324807	ABM	500 ng	EUR 329

ATG9A Protein Vector (Human) (pPB-His-MBP)
PV324810	ABM	500 ng	EUR 329

ATG9A Protein Vector (Human) (pPB-His-GST)
PV324811	ABM	500 ng	EUR 329

ATG9A Protein Vector (Rat) (pPB-C-His)
PV255118	ABM	500 ng	EUR 1191

ATG9A Protein Vector (Rat) (pPB-N-His)
PV255119	ABM	500 ng	EUR 1191

ATG9A Protein Vector (Rat) (pPM-C-HA)
PV255120	ABM	500 ng	EUR 1191

ATG9A Protein Vector (Rat) (pPM-C-His)
PV255121	ABM	500 ng	EUR 1191

ATG9A Protein Vector (Mouse) (pPB-C-His)
PV157062	ABM	500 ng	EUR 1065

ATG9A Protein Vector (Mouse) (pPB-N-His)
PV157063	ABM	500 ng	EUR 1065

ATG9A Protein Vector (Mouse) (pPM-C-HA)
PV157064	ABM	500 ng	EUR 1065

ATG9A Protein Vector (Mouse) (pPM-C-His)
PV157065	ABM	500 ng	EUR 1065

Atg9a 3'UTR Luciferase Stable Cell Line
TU201033	ABM	1.0 ml	Ask for price

Atg9a 3'UTR GFP Stable Cell Line
TU152276	ABM	1.0 ml	Ask for price

ATG9A 3'UTR Luciferase Stable Cell Line
TU001344	ABM	1.0 ml	EUR 2333

Atg9a 3'UTR Luciferase Stable Cell Line
TU102276	ABM	1.0 ml	Ask for price

ATG9A 3'UTR GFP Stable Cell Line
TU051344	ABM	1.0 ml	EUR 2333

Atg9a 3'UTR GFP Stable Cell Line
TU251033	ABM	1.0 ml	Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Atg9a Rabbit Polyclonal Antibody