Atg9a Rabbit Polyclonal Antibody

Atg9a Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

Polyclonal ATG9A Antibody
APG02065G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG9A . This antibody is tested and proven to work in the following applications:
Atg9a Polyclonal Antibody
ABP57483-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide of Atg9a
  • Applications tips:
Description: A polyclonal antibody for detection of Atg9a from Human, Mouse, Rat. This Atg9a antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of Atg9a
Atg9a Polyclonal Antibody
ABP57483-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide of Atg9a
  • Applications tips:
Description: A polyclonal antibody for detection of Atg9a from Human, Mouse, Rat. This Atg9a antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of Atg9a
Atg9a Polyclonal Antibody
ABP57483-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide of Atg9a
  • Applications tips:
Description: A polyclonal antibody for detection of Atg9a from Human, Mouse, Rat. This Atg9a antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of Atg9a
Atg9a Polyclonal Antibody
ES8476-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Atg9a from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Atg9a Polyclonal Antibody
ES8476-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Atg9a from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
ATG9A Rabbit pAb
A7994-100ul 100 ul
EUR 308
ATG9A Rabbit pAb
A7994-200ul 200 ul
EUR 459
ATG9A Rabbit pAb
A7994-20ul 20 ul
EUR 183
ATG9A Rabbit pAb
A7994-50ul 50 ul
EUR 223
ATG9A Rabbit pAb
A5571-100ul 100 ul
EUR 308
ATG9A Rabbit pAb
A5571-200ul 200 ul
EUR 459
ATG9A Rabbit pAb
A5571-20ul 20 ul
EUR 183
ATG9A Rabbit pAb
A5571-50ul 50 ul
EUR 223
Polyclonal ATG9A Antibody (Center)
APG02067G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG9A (Center). This antibody is tested and proven to work in the following applications:
Anti-ATG9A Rabbit Monoclonal Antibody
M03757 100ug/vial
EUR 397
Description: Rabbit Monoclonal ATG9A Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.
ATG9A Antibody
25202-100ul 100ul
EUR 390
ATG9A Antibody
36225-100ul 100ul
EUR 252
ATG9A Antibody
48988-100ul 100ul
EUR 333
ATG9A Antibody
48988-50ul 50ul
EUR 239
ATG9A Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ATG9A. Recognizes ATG9A from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200
ATG9A Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ATG9A. Recognizes ATG9A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
ATG9A Antibody
DF2695 200ul
EUR 304
Description: ATG9A antibody detects endogenous levels of total ATG9A.
ATG9A Antibody
DF8034 200ul
EUR 304
Description: ATG9A Antibody detects endogenous levels of total ATG9A.
ATG9A Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ATG9A. Recognizes ATG9A from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100
Atg9a antibody
70R-9633 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Atg9a antibody
ATG9A antibody
70R-6415 50 ug
EUR 467
Description: Rabbit polyclonal ATG9A antibody
ATG9A Antibody
ABD2695 100 ug
EUR 438
ATG9A Antibody
ABD8034 100 ug
EUR 438
ATG9A Antibody
ABD8346 100 ug
EUR 438
Polyclonal ATG9A Antibody (C-Terminus)
APG02066G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG9A (C-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal ATG9A Antibody (C-term)
APR07027G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG9A (C-term). This antibody is tested and proven to work in the following applications:
ATG9A Conjugated Antibody
C48988 100ul
EUR 397
ATG9A Conjugated Antibody
C36225 100ul
EUR 397
Anti-ATG9A antibody
STJ110301 100 µl
EUR 277
Anti-ATG9A antibody
STJ117815 100 µl
EUR 277
Anti-ATG9A antibody
STJ13100025 150 µl
EUR 427
Anti-Atg9a antibody
STJ98589 200 µl
EUR 197
Description: Rabbit polyclonal to Atg9a.
Atg9a/ Rat Atg9a ELISA Kit
ELI-49603r 96 Tests
EUR 886
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Rabbit Anti-ATG9A monoclonal antibody, clone TD78-16
CABT-L711 100 ul
EUR 777
ATG9A recombinant monoclonal antibody
A5123 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human ATG9A for WB,ELISA
Atg9a Blocking Peptide
33R-1246 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LARGE antibody, catalog no. 70R-6856
ATG9A Blocking Peptide
33R-9437 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ATG9A antibody, catalog no. 70R-6415
ATG9A Blocking Peptide
DF2695-BP 1mg
EUR 195
ATG9A Blocking Peptide
DF8034-BP 1mg
EUR 195
ATG9A cloning plasmid
CSB-CL773782HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1566
  • Sequence: atggtgaaccacagtcttcaccctactgaacccgtcaaggtcactctgccagacgcctttttgcctgctcaagtctgtagtgccaggattcaggaaaatggctcccttatcaccatcctggtcattgctggtgtcttctggatccaccggcttatcaagttcatctataacattt
  • Show more
Description: A cloning plasmid for the ATG9A gene.
ATG9A cloning plasmid
CSB-CL773782HU2-10ug 10ug
EUR 553
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1587
  • Sequence: atggcgcagtttgacactgaataccagcgcctagaggcctcctatagtgattcacccccaggggaggaggacctgttggtgcacgtcgccgaggggagcaagtcaccttggcaccatattgaaaaccttgacctcttcttctctcgagtttataatctgcaccagaagaatggct
  • Show more
Description: A cloning plasmid for the ATG9A gene.
Autophagy Related 9A (ATG9A) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Autophagy Related 9A (ATG9A) Antibody
abx030060-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Autophagy Related 9A (ATG9A) Antibody
abx030060-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Autophagy Related 9A (ATG9A) Antibody
abx030061-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Autophagy Related 9A (ATG9A) Antibody
abx030061-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Autophagy Related 9A (ATG9A) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Autophagy Related 9A (ATG9A) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Autophagy Related 9A (ATG9A) Antibody
abx412192-01mg 0.1 mg
EUR 537
  • Shipped within 1 week.
Autophagy Related 9A (ATG9A) Antibody
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Autophagy Related 9A (ATG9A) Antibody
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rabbit Autophagy related protein 9A(ATG9A) ELISA kit
E04A1751-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Autophagy related protein 9A(ATG9A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Autophagy related protein 9A(ATG9A) ELISA kit
E04A1751-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Autophagy related protein 9A(ATG9A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Autophagy related protein 9A(ATG9A) ELISA kit
E04A1751-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Autophagy related protein 9A(ATG9A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat ATG9A shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse ATG9A shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human ATG9A shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
pCMV-Flag-ATG9A Plasmid
PVTB01039-2a 2 ug
EUR 356
Atg9a ORF Vector (Rat) (pORF)
ORF063780 1.0 ug DNA
EUR 506
ATG9A ORF Vector (Human) (pORF)
ORF000742 1.0 ug DNA
EUR 95
ATG9A ORF Vector (Human) (pORF)
ORF000743 1.0 ug DNA
EUR 95
Atg9a ORF Vector (Mouse) (pORF)
ORF039266 1.0 ug DNA
EUR 506
pECMV-Atg9a-m-FLAG Plasmid
PVT15103 2 ug
EUR 325
Atg9a sgRNA CRISPR Lentivector set (Rat)
K7300301 3 x 1.0 ug
EUR 339
Atg9a sgRNA CRISPR Lentivector set (Mouse)
K4301701 3 x 1.0 ug
EUR 339
ATG9A sgRNA CRISPR Lentivector set (Human)
K0142601 3 x 1.0 ug
EUR 339
Atg9a sgRNA CRISPR Lentivector (Rat) (Target 1)
K7300302 1.0 ug DNA
EUR 154
Atg9a sgRNA CRISPR Lentivector (Rat) (Target 2)
K7300303 1.0 ug DNA
EUR 154
Atg9a sgRNA CRISPR Lentivector (Rat) (Target 3)
K7300304 1.0 ug DNA
EUR 154
Atg9a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4301702 1.0 ug DNA
EUR 154
Atg9a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4301703 1.0 ug DNA
EUR 154
Atg9a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4301704 1.0 ug DNA
EUR 154
ATG9A sgRNA CRISPR Lentivector (Human) (Target 1)
K0142602 1.0 ug DNA
EUR 154
ATG9A sgRNA CRISPR Lentivector (Human) (Target 2)
K0142603 1.0 ug DNA
EUR 154
ATG9A sgRNA CRISPR Lentivector (Human) (Target 3)
K0142604 1.0 ug DNA
EUR 154
ATG9A Protein Vector (Mouse) (pPB-C-His)
PV157062 500 ng
EUR 1065
ATG9A Protein Vector (Mouse) (pPB-N-His)
PV157063 500 ng
EUR 1065
ATG9A Protein Vector (Mouse) (pPM-C-HA)
PV157064 500 ng
EUR 1065
ATG9A Protein Vector (Mouse) (pPM-C-His)
PV157065 500 ng
EUR 1065
ATG9A Protein Vector (Rat) (pPB-C-His)
PV255118 500 ng
EUR 1191
ATG9A Protein Vector (Rat) (pPB-N-His)
PV255119 500 ng
EUR 1191
ATG9A Protein Vector (Rat) (pPM-C-HA)
PV255120 500 ng
EUR 1191
ATG9A Protein Vector (Rat) (pPM-C-His)
PV255121 500 ng
EUR 1191
ATG9A Protein Vector (Human) (pPB-His-MBP)
PV324806 500 ng
EUR 329
ATG9A Protein Vector (Human) (pPB-His-GST)
PV324807 500 ng
EUR 329
ATG9A Protein Vector (Human) (pPB-His-MBP)
PV324810 500 ng
EUR 329
ATG9A Protein Vector (Human) (pPB-His-GST)
PV324811 500 ng
EUR 329
ATG9A Protein Vector (Human) (pPB-C-His)
PV002965 500 ng
EUR 329
ATG9A Protein Vector (Human) (pPB-N-His)
PV002966 500 ng
EUR 329
ATG9A Protein Vector (Human) (pPM-C-HA)
PV002967 500 ng
EUR 329

Atg9a Rabbit Polyclonal Antibody