GABARAP Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

GABARAP Polyclonal Antibody
ABP57489-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthetic Peptide of GABARAP Applications tips:
Description: A polyclonal antibody for detection of GABARAP from Human, Mouse, Rat. This GABARAP antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of GABARAP

GABARAP Polyclonal Antibody
ES8482-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against GABARAP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GABARAP Polyclonal Antibody
ES8482-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against GABARAP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GABARAP Rabbit pAb
A13855-100ul	Abclonal	100 ul	EUR 308

GABARAP Rabbit pAb
A13855-200ul	Abclonal	200 ul	EUR 459

GABARAP Rabbit pAb
A13855-20ul	Abclonal	20 ul	EUR 183

GABARAP Rabbit pAb
A13855-50ul	Abclonal	50 ul	EUR 223

GABARAP Rabbit pAb
A12568-100ul	Abclonal	100 ul	EUR 308

GABARAP Rabbit pAb
A12568-200ul	Abclonal	200 ul	EUR 459

GABARAP Rabbit pAb
A12568-20ul	Abclonal	20 ul	EUR 183

GABARAP Rabbit pAb
A12568-50ul	Abclonal	50 ul	EUR 223

GABARAP Rabbit mAb
A4335-100ul	Abclonal	100 ul	EUR 410

GABARAP Rabbit mAb
A4335-200ul	Abclonal	200 ul	EUR 571

GABARAP Rabbit mAb
A4335-20ul	Abclonal	20 ul	EUR 221

GABARAP Rabbit mAb
A4335-50ul	Abclonal	50 ul	EUR 287

GABARAP Rabbit pAb
A5616-100ul	Abclonal	100 ul	EUR 308

GABARAP Rabbit pAb
A5616-200ul	Abclonal	200 ul	EUR 459

GABARAP Rabbit pAb
A5616-20ul	Abclonal	20 ul	EUR 183

GABARAP Rabbit pAb
A5616-50ul	Abclonal	50 ul	EUR 223

Polyclonal GABARAP Antibody (N-term)
APG03029G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GABARAP (N-term). This antibody is tested and proven to work in the following applications:

GABARAP Polyclonal Antibody, HRP Conjugated
A51798	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

GABARAP Polyclonal Antibody, FITC Conjugated
A51799	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

GABARAP Polyclonal Antibody, Biotin Conjugated
A51800	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

GABARAP antibody
70R-17388	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal GABARAP antibody

GABARAP antibody
70R-2213	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal GABARAP antibody

GABARAP Antibody
32924-100ul	SAB	100ul	EUR 252

GABARAP Antibody
49642-100ul	SAB	100ul	EUR 333

GABARAP Antibody
49642-50ul	SAB	50ul	EUR 239

GABARAP Antibody
1-CSB-PA05484A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GABARAP. Recognizes GABARAP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:100-1:200

GABARAP Antibody
DF7419	Affbiotech	200ul	EUR 304
Description: GABARAP Antibody detects endogenous levels of total GABARAP.

GABARAP antibody
70R-GR028	Fitzgerald	100 ug	EUR 300
Description: Affinity purified Rabbit polyclonal GABARAP antibody

GABARAP antibody
70R-9080	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal GABARAP antibody

GABARAP antibody
70R-9625	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal GABARAP antibody

GABARAP Antibody
1-CSB-PA009130GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GABARAP. Recognizes GABARAP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GABARAP Antibody
ABD7419	Lifescience Market	100 ug	EUR 438

Human GABARAP Antibody
33046-05111	AssayPro	150 ug	EUR 261

Anti-GABARAP Antibody
A01927	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for GABARAP Antibody (GABARAPL2) detection. Tested with WB in Human, Mouse, Rat.

GABARAP Conjugated Antibody
C49642	SAB	100ul	EUR 397

GABARAP Conjugated Antibody
C32924	SAB	100ul	EUR 397

anti- GABARAP antibody
FNab03274	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 Immunogen: GABA(A) receptor-associated protein Uniprot ID: O95166 Gene ID: 11337 Research Area: Neuroscience, Signal Transduction, Metabolism, Cancer
Description: Antibody raised against GABARAP

Anti-GABARAP antibody
PAab03274	Lifescience Market	100 ug	EUR 386

Anti-GABARAP antibody
STJ27583	St John's Laboratory	100 µl	EUR 277
Description: Gamma-aminobutyric acid A receptors [GABA(A) receptors] are ligand-gated chloride channels that mediate inhibitory neurotransmission. This gene encodes GABA(A) receptor-associated protein, which is highly positively charged in its N-terminus and shares sequence similarity with light chain-3 of microtubule-associated proteins 1A and 1B. This protein clusters neurotransmitter receptors by mediating interaction with the cytoskeleton.

Anti-GABARAP antibody
STJ114442	St John's Laboratory	100 µl	EUR 277
Description: Gamma-aminobutyric acid A receptors [GABA(A) receptors] are ligand-gated chloride channels that mediate inhibitory neurotransmission. This gene encodes GABA(A) receptor-associated protein, which is highly positively charged in its N-terminus and shares sequence similarity with light chain-3 of microtubule-associated proteins 1A and 1B. This protein clusters neurotransmitter receptors by mediating interaction with the cytoskeleton.

Anti-GABARAP antibody
STJ115794	St John's Laboratory	100 µl	EUR 277
Description: Gamma-aminobutyric acid A receptors [GABA(A) receptors] are ligand-gated chloride channels that mediate inhibitory neurotransmission. This gene encodes GABA(A) receptor-associated protein, which is highly positively charged in its N-terminus and shares sequence similarity with light chain-3 of microtubule-associated proteins 1A and 1B. This protein clusters neurotransmitter receptors by mediating interaction with the cytoskeleton.

Anti-GABARAP antibody
STJ98595	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to GABARAP.

GABARAP siRNA
20-abx902057	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GABARAP siRNA
20-abx917412	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GABARAP siRNA
20-abx917413	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-GABARAP
YF-PA25792	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to GABARAP

GABARAP Antibody, HRP conjugated
1-CSB-PA05484B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GABARAP. Recognizes GABARAP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GABARAP Antibody, FITC conjugated
1-CSB-PA05484C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GABARAP. Recognizes GABARAP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GABARAP Antibody, Biotin conjugated
1-CSB-PA05484D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GABARAP. Recognizes GABARAP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GABARAP recombinant monoclonal antibody
A5209	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human GABARAP for WB, IHC,ELISA

Anti-GABARAP Monoclonal Antibody
M01907	BosterBio	100ug	EUR 397
Description: Rabbit Monoclonal GABARAP Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Antibody for Human GABARAP
SPC-620D	Stressmarq	0.1mg	EUR 354
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is unconjugated.

Antibody for Human GABARAP
SPC-620D-A390	Stressmarq	0.1mg	EUR 401
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 390.

Antibody for Human GABARAP
SPC-620D-A488	Stressmarq	0.1mg	EUR 400
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 488.

Antibody for Human GABARAP
SPC-620D-A565	Stressmarq	0.1mg	EUR 400
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 565.

Antibody for Human GABARAP
SPC-620D-A594	Stressmarq	0.1mg	EUR 400
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 594.

Antibody for Human GABARAP
SPC-620D-A633	Stressmarq	0.1mg	EUR 400
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 633.

Antibody for Human GABARAP
SPC-620D-A655	Stressmarq	0.1mg	EUR 400
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 655.

Antibody for Human GABARAP
SPC-620D-A680	Stressmarq	0.1mg	EUR 400
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 680.

Antibody for Human GABARAP
SPC-620D-A700	Stressmarq	0.1mg	EUR 400
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 700.

Antibody for Human GABARAP
SPC-620D-ALP	Stressmarq	0.1mg	EUR 394
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Alkaline Phosphatase.

Antibody for Human GABARAP
SPC-620D-APC	Stressmarq	0.1mg	EUR 399
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to APC .

Antibody for Human GABARAP
SPC-620D-APCCY7	Stressmarq	0.1mg	EUR 471
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to APC/Cy7.

Antibody for Human GABARAP
SPC-620D-BI	Stressmarq	0.1mg	EUR 396
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Biotin.

Antibody for Human GABARAP
SPC-620D-DY350	Stressmarq	0.1mg	EUR 414
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 350.

Antibody for Human GABARAP
SPC-620D-DY405	Stressmarq	0.1mg	EUR 403
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 405.

Antibody for Human GABARAP
SPC-620D-DY488	Stressmarq	0.1mg	EUR 393
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 488.

Antibody for Human GABARAP
SPC-620D-DY594	Stressmarq	0.1mg	EUR 395
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 594.

Antibody for Human GABARAP
SPC-620D-DY633	Stressmarq	0.1mg	EUR 390
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 633.

Antibody for Human GABARAP
SPC-620D-FITC	Stressmarq	0.1mg	EUR 392
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to FITC.

Antibody for Human GABARAP
SPC-620D-HRP	Stressmarq	0.1mg	EUR 388
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to HRP.

Antibody for Human GABARAP
SPC-620D-P594	Stressmarq	0.1mg	EUR 407
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to PE/ATTO 594.

Antibody for Human GABARAP
SPC-620D-PCP	Stressmarq	0.1mg	EUR 399
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to PerCP.

Antibody for Human GABARAP
SPC-620D-RPE	Stressmarq	0.1mg	EUR 397
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to RPE .

Antibody for Human GABARAP
SPC-620D-STR	Stressmarq	0.1mg	EUR 398
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Streptavidin.

Antibody for Human GABARAP
SPC-620S	Stressmarq	0.012mg	EUR 65
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is unconjugated.

Antibody for Human GABARAP
SPC-621D	Stressmarq	0.1mg	EUR 354
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is unconjugated.

Antibody for Human GABARAP
SPC-621D-A390	Stressmarq	0.1mg	EUR 401
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 390.

Antibody for Human GABARAP
SPC-621D-A488	Stressmarq	0.1mg	EUR 400
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 488.

Antibody for Human GABARAP
SPC-621D-A565	Stressmarq	0.1mg	EUR 400
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 565.

Antibody for Human GABARAP
SPC-621D-A594	Stressmarq	0.1mg	EUR 400
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 594.

Antibody for Human GABARAP
SPC-621D-A633	Stressmarq	0.1mg	EUR 400
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 633.

Antibody for Human GABARAP
SPC-621D-A655	Stressmarq	0.1mg	EUR 400
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 655.

Antibody for Human GABARAP
SPC-621D-A680	Stressmarq	0.1mg	EUR 400
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 680.

Antibody for Human GABARAP
SPC-621D-A700	Stressmarq	0.1mg	EUR 400
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 700.

Antibody for Human GABARAP
SPC-621D-ALP	Stressmarq	0.1mg	EUR 394
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Alkaline Phosphatase.

Antibody for Human GABARAP
SPC-621D-APC	Stressmarq	0.1mg	EUR 399
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to APC .

Antibody for Human GABARAP
SPC-621D-APCCY7	Stressmarq	0.1mg	EUR 471
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to APC/Cy7.

Antibody for Human GABARAP
SPC-621D-BI	Stressmarq	0.1mg	EUR 396
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Biotin.

Antibody for Human GABARAP
SPC-621D-DY350	Stressmarq	0.1mg	EUR 414
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 350.

Antibody for Human GABARAP
SPC-621D-DY405	Stressmarq	0.1mg	EUR 403
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 405.

Antibody for Human GABARAP
SPC-621D-DY488	Stressmarq	0.1mg	EUR 393
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 488.

Antibody for Human GABARAP
SPC-621D-DY594	Stressmarq	0.1mg	EUR 395
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 594.

Antibody for Human GABARAP
SPC-621D-DY633	Stressmarq	0.1mg	EUR 390
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 633.

Antibody for Human GABARAP
SPC-621D-FITC	Stressmarq	0.1mg	EUR 392
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to FITC.

Antibody for Human GABARAP
SPC-621D-HRP	Stressmarq	0.1mg	EUR 388
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to HRP.

Antibody for Human GABARAP
SPC-621D-P594	Stressmarq	0.1mg	EUR 407
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to PE/ATTO 594.

Antibody for Human GABARAP
SPC-621D-PCP	Stressmarq	0.1mg	EUR 399
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to PerCP.

Antibody for Human GABARAP
SPC-621D-RPE	Stressmarq	0.1mg	EUR 397
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to RPE .

Antibody for Human GABARAP
SPC-621D-STR	Stressmarq	0.1mg	EUR 398
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Streptavidin.

Antibody for Human GABARAP
SPC-621S	Stressmarq	0.012mg	EUR 65
Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is unconjugated.

GABA(A) receptor-associated protein (GABARAP) polyclonal antibody
ABP-PAB-10146	Allele Biotech	100 ug	Ask for price
Product line: Neuroscience Brand:

GABARAP Blocking Peptide
33R-3983	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GABARAP antibody, catalog no. 70R-9625

GABARAP Blocking Peptide
33R-4134	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GABARAP antibody, catalog no. 70R-9080

GABARAP Blocking Peptide
33R-4382	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GABARAP antibody, catalog no. 70R-2213

GABARAP Blocking Peptide
DF7419-BP	Affbiotech	1mg	EUR 195

GABARAP cloning plasmid
CSB-CL009130HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 354 Sequence: ATGAAGTTCGTGTACAAAGAAGAGCATCCGTTCGAGAAGCGCCGCTCTGAGGGCGAGAAGATCCGAAAGAAATACCCGGACCGGGTGCCGGTGATAGTAGAAAAGGCTCCCAAAGCTCGGATAGGAGACCTGGACAAAAAGAAATACCTGGTGCCTTCTGATCTCACAGTTGGTCA Show more
Description: A cloning plasmid for the GABARAP gene.

pDONR223-GABARAP Plasmid
PVTB00829	Lifescience Market	2 ug	EUR 356

Anti-GABARAP (1G7)
YF-MA20508	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to GABARAP

Anti-GABARAP (4E12)
YF-MA20509	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to GABARAP

Human GABARAP Antibody (Biotin Conjugate)
33046-05121	AssayPro	150 ug	EUR 369

Monoclonal GABARAP Antibody, Clone: 424CT5.1.6
APR11965G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human GABARAP. The antibodies are raised in Mouse and are from clone 424CT5.1.6. This antibody is applicable in WB, E

Human GABARAP AssayLite Antibody (FITC Conjugate)
33046-05141	AssayPro	150 ug	EUR 428

Human GABARAP AssayLite Antibody (RPE Conjugate)
33046-05151	AssayPro	150 ug	EUR 428

Human GABARAP AssayLite Antibody (APC Conjugate)
33046-05161	AssayPro	150 ug	EUR 428

Human GABARAP AssayLite Antibody (PerCP Conjugate)
33046-05171	AssayPro	150 ug	EUR 471

Monoclonal GABARAP Antibody(Ascites), Clone: 424CT5.1.6
APG03307G	Leading Biology	0.1 ml	EUR 484
Description: A Monoclonal antibody against Human GABARAP(Ascites). The antibodies are raised in Mouse and are from clone 424CT5.1.6. This antibody is applicable in WB, E

GABARAP protein (His tag)
80R-1246	Fitzgerald	100 ug	EUR 268
Description: Purified recombinant Human GABARAP protein

GABARAP ELISA KIT|Human
EF009735	Lifescience Market	96 Tests	EUR 689

Mouse GABARAP shRNA Plasmid
20-abx974803	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat GABARAP shRNA Plasmid
20-abx985950	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GABARAP shRNA Plasmid
20-abx957764	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Recombinant human GABARAP-a
P1250	FN Test	100ug	Ask for price
Uniprot ID: H6UMI1 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human GABARAP-a

GABARAP Recombinant Protein (Human)
RP039349	ABM	100 ug	Ask for price

GABARAP Recombinant Protein (Rat)
RP202025	ABM	100 ug	Ask for price

GABARAP Recombinant Protein (Mouse)
RP135647	ABM	100 ug	Ask for price

GABA-A Receptor Associated Protein (GABARAP) Antibody
20-abx004293	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody
20-abx112650	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody
20-abx109803	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody
20-abx141778	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody
abx030109-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody
abx030109-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody
abx233274-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody
abx448497-100ug	Abbexa	100 ug	EUR 523
Shipped within 5-12 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody
abx448498-100ug	Abbexa	100 ug	EUR 523
Shipped within 5-12 working days.

Rabbit Anti-Human GABA Receptor Associated Protein (GABARAP) antiserum #1
GABARAP11-S	Alpha Diagnostics	100 ul	EUR 457

Gabarap ORF Vector (Rat) (pORF)
ORF067343	ABM	1.0 ug DNA	EUR 506

GABARAP ORF Vector (Human) (pORF)
ORF013117	ABM	1.0 ug DNA	EUR 354

Gabarap ORF Vector (Mouse) (pORF)
ORF045217	ABM	1.0 ug DNA	EUR 506

GABA-A Receptor Associated Protein (GABARAP) Antibody (Biotin)
20-abx105437	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody (FITC)
20-abx106856	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody (HRP)
20-abx108276	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody Pair
abx117423-1pair5x96wellplates	Abbexa	1 pair (5x96 well plates)	EUR 1010
Shipped within 5-10 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody (ALP)
abx446976-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody (ALP)
abx446977-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody (APC)
abx446978-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody (APC)
abx446979-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody (Biotin)
abx446980-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody (Biotin)
abx446981-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody (FITC)
abx446982-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody (FITC)
abx446983-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody (HRP)
abx446984-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody (HRP)
abx446985-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody (PerCP)
abx446988-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody (PerCP)
abx446989-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody (RPE)
abx446990-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody (RPE)
abx446991-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody (Streptavidin)
abx446992-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody (Streptavidin)
abx446993-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Gabarap sgRNA CRISPR Lentivector set (Rat)
K6840601	ABM	3 x 1.0 ug	EUR 339

GABARAP Rabbit Polyclonal Antibody