STAT5b Rabbit Polyclonal Antibody

STAT5b Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

STAT5b Polyclonal Antibody
EA247-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against STAT5b from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC
STAT5b Polyclonal Antibody
ES8276-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against STAT5b from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
STAT5b Polyclonal Antibody
ES8276-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against STAT5b from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
STAT5b Polyclonal Antibody
ABP57277-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of STAT5b from Human, Mouse, Rat. This STAT5b antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
STAT5b Polyclonal Antibody
ABP57277-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of STAT5b from Human, Mouse, Rat. This STAT5b antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
STAT5b Polyclonal Antibody
ABP57277-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of STAT5b from Human, Mouse, Rat. This STAT5b antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
STAT5B Polyclonal Antibody
A68312 100 µl
EUR 483.55
Description: fast delivery possible
STAT5B Rabbit pAb
A0275-100ul 100 ul
EUR 308
STAT5B Rabbit pAb
A0275-200ul 200 ul
EUR 459
STAT5B Rabbit pAb
A0275-20ul 20 ul
EUR 183
STAT5B Rabbit pAb
A0275-50ul 50 ul
EUR 223
STAT5B Rabbit pAb
A12356-100ul 100 ul
EUR 308
STAT5B Rabbit pAb
A12356-200ul 200 ul
EUR 459
STAT5B Rabbit pAb
A12356-20ul 20 ul
EUR 183
STAT5B Rabbit pAb
A12356-50ul 50 ul
EUR 223
STAT5A/STAT5B Polyclonal Antibody
30233-100ul 100ul
EUR 252
STAT5A/STAT5B Polyclonal Antibody
30233-50ul 50ul
EUR 187
Anti-STAT5b Rabbit Monoclonal Antibody
M00681 100ug/vial
EUR 397
Description: Rabbit Monoclonal STAT5b Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.
Human Signal Transducer And Activator Of Transcription 5B (STAT5B) ELISA Kit
EUR 498
  • Should the Human Signal Transducer And Activator Of Transcription 5B (STAT5B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Signal Transducer And Activator Of Transcription 5B (STAT5B) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Signal Transducer And Activator Of Transcription 5B (STAT5B) ELISA Kit
EUR 647
  • Should the Human Signal Transducer And Activator Of Transcription 5B (STAT5B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Signal Transducer And Activator Of Transcription 5B (STAT5B) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Signal Transducer And Activator Of Transcription 5B (STAT5B) ELISA Kit
RD-STAT5B-Hu-48Tests 48 Tests
EUR 500
Human Signal Transducer And Activator Of Transcription 5B (STAT5B) ELISA Kit
RD-STAT5B-Hu-96Tests 96 Tests
EUR 692
Human Signal Transducer And Activator Of Transcription 5B (STAT5B) ELISA Kit
RDR-STAT5B-Hu-48Tests 48 Tests
EUR 522
Human Signal Transducer And Activator Of Transcription 5B (STAT5B) ELISA Kit
RDR-STAT5B-Hu-96Tests 96 Tests
EUR 724
Polyclonal STAT5B antibody - middle region
APR00698G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STAT5B - middle region. This antibody is tested and proven to work in the following applications:
Polyclonal STAT5b Antibody (C-term)
APR10280G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STAT5b (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal STAT5B Antibody (N-Terminus)
APR10286G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STAT5B (N-Terminus). This antibody is tested and proven to work in the following applications:
STAT5A/STAT5B Polyclonal Conjugated Antibody
C30233 100ul
EUR 397
ERTS0218 96Tests
EUR 521
STAT5A/STAT5B Rabbit pAb
A17930-100ul 100 ul
EUR 308
STAT5A/STAT5B Rabbit pAb
A17930-200ul 200 ul
EUR 459
STAT5A/STAT5B Rabbit pAb
A17930-20ul 20 ul
EUR 183
STAT5A/STAT5B Rabbit pAb
A17930-50ul 50 ul
EUR 223
STAT5B Antibody
AF6340 200ul
EUR 304
Description: STAT5B Antibody detects endogenous levels of total STAT5B.
STAT5B Antibody
BF0158 200ul
EUR 376
Description: STAT5B antibody detects endogenous levels of total STAT5B.
STAT5B Antibody
ABF6340 100 ug
EUR 438
STAT5B antibody
70R-31062 100 ug
EUR 327
Description: Rabbit polyclonal STAT5B antibody
STAT5B antibody
70R-7985 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal STAT5B antibody
Stat5b antibody
70R-8200 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Stat5b antibody
STAT5B antibody
70R-8299 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal STAT5B antibody
STAT5B antibody
70R-8300 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal STAT5B antibody
STAT5B Antibody
ABD6078 100 ug
EUR 438
STAT5b Antibody
49176-100ul 100ul
EUR 333
STAT5b Antibody
49176-50ul 50ul
EUR 239
STAT5B antibody
10R-1256 100 ug
EUR 512
Description: Mouse monoclonal STAT5B antibody
STAT5B Antibody
32059-100ul 100ul
EUR 252
STAT5B antibody
10R-2214 100 ul
EUR 403
Description: Mouse monoclonal STAT5B antibody
STAT5B antibody
20R-1134 100 ug
EUR 377
Description: Rabbit polyclonal STAT5B antibody
STAT5B antibody
20R-2917 100 ul
EUR 393
Description: Rabbit polyclonal STAT5B antibody
STAT5B antibody
70R-20576 50 ul
EUR 435
Description: Rabbit polyclonal STAT5B antibody
STAT5B Antibody
DF6078 200ul
EUR 304
Description: STAT5B Antibody detects endogenous levels of total STAT5B.
STAT5B Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STAT5B. Recognizes STAT5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:500-1:10000, IHC:1:10-1:50
STAT5B Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against STAT5B. Recognizes STAT5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:500-1:2000.IHC:1:50-1:200
STAT5B Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STAT5B. Recognizes STAT5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:500-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
STAT5B Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STAT5B. Recognizes STAT5B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, ChIP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
STAT5B Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STAT5B. Recognizes STAT5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
STAT5B Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STAT5B. Recognizes STAT5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000
Polyclonal Stat5b antibody - C-terminal region
APR00699G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Stat5b - C-terminal region. This antibody is tested and proven to work in the following applications:
STAT5B (Phospho-Ser731) Polyclonal Conjugated Antibody
C12152 100ul
EUR 397
[KO Validated] STAT5b Rabbit mAb
A19567-100ul 100 ul
EUR 410
[KO Validated] STAT5b Rabbit mAb
A19567-200ul 200 ul
EUR 571
[KO Validated] STAT5b Rabbit mAb
A19567-20ul 20 ul
EUR 221
[KO Validated] STAT5b Rabbit mAb
A19567-50ul 50 ul
EUR 287
STAT5b Conjugated Antibody
C49176 100ul
EUR 397
anti- STAT5B antibody
FNab08305 100µg
EUR 548.75
  • Immunogen: signal transducer and activator of transcription 5B
  • Uniprot ID: P51692
  • Gene ID: 6777
  • Research Area: Epigenetics, Signal Transduction, Metabolism, Cardiovascular, Developmental biology, Stem Cells
Description: Antibody raised against STAT5B
anti- STAT5B antibody
FNab08306 100µg
EUR 585
  • Immunogen: signal transducer and activator of transcription 5B
  • Uniprot ID: P51692
  • Gene ID: 6777
  • Research Area: Epigenetics, Signal Transduction, Metabolism, Cardiovascular, Developmental biology, Stem Cells
Description: Antibody raised against STAT5B
STAT5B (pS731) Antibody
abx011812-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
STAT5A / STAT5B Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
STAT5A / STAT5B Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
STAT5B antibody (Ser731)
70R-31061 100 ug
EUR 327
Description: Rabbit polyclonal STAT5B antibody (Ser731)
Anti-STAT5B Antibody
EUR 479
STAT5A/STAT5B Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against STAT5A/STAT5B. Recognizes STAT5A/STAT5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000
STAT5A/STAT5B Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against STAT5A/STAT5B. Recognizes STAT5A/STAT5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000
Anti-STAT5b Antibody
PB9512 100ug/vial
EUR 294
Anti-STAT5B antibody
PAab08305 100 ug
EUR 386
Anti-STAT5B antibody
PAab08306 100 ug
EUR 412
Anti-STAT5b Antibody
PA1841 100ug/vial
EUR 334
Anti-STAT5b antibody
STJ97482 200 µl
EUR 197
Description: Rabbit polyclonal to STAT5b.
Anti-Stat5b antibody
STJ98401 100 µl
EUR 234
Description: Mouse monoclonal to Stat5b.
Anti-STAT5B antibody
STJ25723 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein mediates the signal transduction triggered by various cell ligands, such as IL2, IL4, CSF1, and different growth hormones. It has been shown to be involved in diverse biological processes, such as TCR signaling, apoptosis, adult mammary gland development, and sexual dimorphism of liver gene expression. This gene was found to fuse to retinoic acid receptor-alpha (RARA) gene in a small subset of acute promyelocytic leukemias (APLL). The dysregulation of the signaling pathways mediated by this protein may be the cause of the APLL.
Anti-STAT5B antibody
STJ114234 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein mediates the signal transduction triggered by various cell ligands, such as IL2, IL4, CSF1, and different growth hormones. It has been shown to be involved in diverse biological processes, such as TCR signaling, apoptosis, adult mammary gland development, and sexual dimorphism of liver gene expression. This gene was found to fuse to retinoic acid receptor-alpha (RARA) gene in a small subset of acute promyelocytic leukemias (APLL). The dysregulation of the signaling pathways mediated by this protein may be the cause of the APLL.
Stat5b/ Rat Stat5b ELISA Kit
ELI-52860r 96 Tests
EUR 886
Rabbit Anti-STAT5B monoclonal antibody, clone TE19-19
CABT-L798 100 ul
EUR 777
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
STAT5b protein
E20-80109 20ug
EUR 408
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
LF-PA0069 100 ul
EUR 334
Description: Rabbit polyclonal to STAT5B
YF-PA14821 50 ul
EUR 363
Description: Mouse polyclonal to STAT5B
YF-PA14822 100 ug
EUR 403
Description: Rabbit polyclonal to STAT5B
YF-PA24782 50 ul
EUR 334
Description: Mouse polyclonal to STAT5B
Phospho-STAT5B (Ser731) Antibody
AF3340 200ul
EUR 304
Description: Phospho-STAT5B (Ser731) Antibody detects endogenous levels of STAT5B only when phosphorylated at Serine 731.
STAT5B (Phospho-Ser731) Antibody
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Phospho- STAT5B (Ser731) Antibody
ABF3340 100 ug
EUR 438
STAT5b recombinant monoclonal antibody
A5003 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human STAT5b for WB, IF,ELISA
STAT5B (Phospho-Ser731) Antibody
12152-100ul 100ul
EUR 252
STAT5B (Phospho-Ser731) Antibody
12152-50ul 50ul
EUR 187
STAT5B (Ab-731) Antibody
33126-100ul 100ul
EUR 252
STAT5B (Ab-731) Antibody
33126-50ul 50ul
EUR 187
Phospho-STAT5B (Ser731) Antibody
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-STAT5B (Ser731). Recognizes Phospho-STAT5B (Ser731) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
Phospho-STAT5B (Ser731) Antibody
CSB-PA220945-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-STAT5B (Ser731). Recognizes Phospho-STAT5B (Ser731) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
STAT5B (Ab-731) Antibody
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against STAT5B (Ab-731). Recognizes STAT5B (Ab-731) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
STAT5B (Ab-731) Antibody
CSB-PA100746-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against STAT5B (Ab-731). Recognizes STAT5B (Ab-731) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
STAT5B Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STAT5B. Recognizes STAT5B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
STAT5B Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STAT5B. Recognizes STAT5B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
STAT5B Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STAT5B. Recognizes STAT5B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Anti-STAT5A/STAT5B antibody
STJ119916 100 µl
EUR 277
Rabbit Anti-STAT5A, STAT5B monoclonal antibody, clone KK19-89
CABT-L830 100 ul
EUR 777
Monoclonal STAT5B Antibody, Clone: 5B3
APR13563G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human STAT5B. The antibodies are raised in Mouse and are from clone 5B3. This antibody is applicable in WB, E
STAT5B (Ab-731) Conjugated Antibody
C33126 100ul
EUR 397
STAT5A / STAT5B (pY694 / 699) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
STAT5A / STAT5B (pS726 / 731) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
STAT5A / STAT5B (pS726 / 731) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Stat5a / Stat5b (pS725 / 730) Antibody
abx333421-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.
STAT5B Blocking Peptide
AF6340-BP 1mg
EUR 195
STAT5B Blocking Peptide
BF0158-BP 1mg
EUR 195
STAT5B cloning plasmid
CSB-CL022815HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1173
  • Sequence: atggctgtgtggatacaagctcagcagctccaaggagaagcccttcatcagatgcaagcgttatatggccagcattttcccattgaggtgcggcattatttatcccagtggattgaaagccaagcatgggactcagtagatcttgataatccacaggagaacattaaggccaccc
  • Show more
Description: A cloning plasmid for the STAT5B gene.
STAT5B Blocking Peptide
33R-3550 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STAT5B antibody, catalog no. 70R-8300
STAT5B Blocking Peptide
33R-3613 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STAT5B antibody, catalog no. 20R-1134
STAT5B Blocking Peptide
33R-5362 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STAT5B antibody, catalog no. 70R-7985
STAT5B Blocking Peptide
33R-1622 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STAT5B antibody, catalog no. 70R-8299
Stat5b Blocking Peptide
33R-7426 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Stat5b antibody, catalog no. 70R-8200
STAT5B Blocking Peptide
DF6078-BP 1mg
EUR 195
anti-STAT5B (1A1)
LF-MA10314 100 ug
EUR 363
Description: Mouse monoclonal to STAT5B
anti-STAT5B (5B3)
LF-MA30430 100 ul
EUR 486
Description: Mouse Monoclonal to STAT5B
Anti-STAT5B (1C2)
YF-MA15641 100 ug
EUR 363
Description: Mouse monoclonal to STAT5B
Anti-STAT5B (1F5)
YF-MA15642 100 ug
EUR 363
Description: Mouse monoclonal to STAT5B
Anti-STAT5B (5D6)
YF-MA10888 100 ug
EUR 363
Description: Mouse monoclonal to STAT5B
Anti-STAT5B (2D1)
YF-MA10889 100 ug
EUR 363
Description: Mouse monoclonal to STAT5B

STAT5b Rabbit Polyclonal Antibody