PENK Rabbit Polyclonal Antibody

PENK Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

Human Proenkephalin (PENK) ELISA Kit

RDR-PENK-Hu-48Tests 48 Tests
EUR 544

Human Proenkephalin (PENK) ELISA Kit

RDR-PENK-Hu-96Tests 96 Tests
EUR 756

Mouse Proenkephalin (PENK) ELISA Kit

RDR-PENK-Mu-48Tests 48 Tests
EUR 557

Mouse Proenkephalin (PENK) ELISA Kit

RDR-PENK-Mu-96Tests 96 Tests
EUR 774

Human Proenkephalin (PENK) ELISA Kit

RD-PENK-Hu-48Tests 48 Tests
EUR 521

Human Proenkephalin (PENK) ELISA Kit

RD-PENK-Hu-96Tests 96 Tests
EUR 723

Mouse Proenkephalin (PENK) ELISA Kit

RD-PENK-Mu-48Tests 48 Tests
EUR 533

Mouse Proenkephalin (PENK) ELISA Kit

RD-PENK-Mu-96Tests 96 Tests
EUR 740

PENK Polyclonal Antibody

46755-100ul 100ul
EUR 252

PENK Polyclonal Antibody

46755-50ul 50ul
EUR 187

PENK Polyclonal Antibody

ABP57554-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic peptide from human protein at AA range: 51-100
  • Applications tips:
Description: A polyclonal antibody for detection of PENK from Human. This PENK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 51-100

PENK Polyclonal Antibody

ABP57554-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 51-100
  • Applications tips:
Description: A polyclonal antibody for detection of PENK from Human. This PENK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 51-100

PENK Polyclonal Antibody

ABP57554-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 51-100
  • Applications tips:
Description: A polyclonal antibody for detection of PENK from Human. This PENK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 51-100

PENK Polyclonal Antibody

ES8547-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PENK from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PENK Polyclonal Antibody

ES8547-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PENK from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PENK Rabbit pAb

A6302-100ul 100 ul
EUR 308

PENK Rabbit pAb

A6302-200ul 200 ul
EUR 459

PENK Rabbit pAb

A6302-20ul 20 ul
EUR 183

PENK Rabbit pAb

A6302-50ul 50 ul
EUR 223

PENK antibody

38808-100ul 100ul
EUR 252

PENK Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against PENK. Recognizes PENK from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000

PENK antibody

70R-6226 50 ug
EUR 467
Description: Rabbit polyclonal PENK antibody raised against the middle region of PENK

Proenkephalin (PENK) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PENK (Glu25~ Phe267)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK)

Proenkephalin (PENK) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PENK (Glu25~ Phe267)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK). This antibody is labeled with APC.

Proenkephalin (PENK) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PENK (Glu25~ Phe267)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK). This antibody is labeled with Biotin.

Proenkephalin (PENK) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PENK (Glu25~ Phe267)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK). This antibody is labeled with Cy3.

Proenkephalin (PENK) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PENK (Glu25~ Phe267)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK). This antibody is labeled with FITC.

Proenkephalin (PENK) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PENK (Glu25~ Phe267)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK). This antibody is labeled with HRP.

Proenkephalin (PENK) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PENK (Glu25~ Phe267)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK). This antibody is labeled with PE.

Proenkephalin (PENK) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proenkephalin (PENK) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Proenkephalin (PENK) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Enkephalin (PENK) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Proenkephalin (PENK) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Proenkephalin (PENK) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proenkephalin (PENK) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

PENK Conjugated Antibody

C38808 100ul
EUR 397

Enkephalin (PENK) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-PENK antibody

STJ28224 100 µl
EUR 277
Description: This gene encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the pentapeptide opioids Met-enkephalin and Leu-enkephalin, which are stored in synaptic vesicles, then released into the synapse where they bind to mu- and delta-opioid receptors to modulate the perception of pain. Other non-opioid cleavage products may function in distinct biological activities.

Anti-PENK antibody

STJ98660 200 µl
EUR 197
Description: Rabbit polyclonal to PENK.

Proenkephalin (PENK) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PENK (Glu25~ Phe267)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK). This antibody is labeled with APC-Cy7.

PENK Blocking Peptide

33R-1846 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PENK antibody, catalog no. 70R-6226

PENK cloning plasmid

CSB-CL017781HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 804
  • Sequence: atggcgcggttcctgacactttgcacttggctgctgttgctcggccccgggctcctggcgaccgtgcgggccgaatgcagccaggattgcgcgacgtgcagctaccgcctagtgcgcccggccgacatcaacttcctggcttgcgtaatggaatgtgaaggtaaactgccttctct
  • Show more
Description: A cloning plasmid for the PENK gene.

Recombinant Proenkephalin (PENK)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P01210
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Proenkephalin expressed in: E.coli

Anti-PENK (9E7)

YF-MA20202 100 ug
EUR 363
Description: Mouse monoclonal to PENK

Enkephalin (PENK) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.


ELA-E0279h 96 Tests
EUR 824


EF000539 96 Tests
EUR 689

Mouse PENK shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PENK shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Proenkephalin (PENK) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Proenkephalin (PENK) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Proenkephalin (PENK) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Enkephalin (PENK) Protein (OVA)

  • EUR 258.00
  • EUR 189.00
  • EUR 537.00
  • EUR 272.00
  • EUR 217.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Enkephalin (PENK) Peptide (KLH)

  • EUR 286.00
  • EUR 203.00
  • EUR 662.00
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Enkephalin (PENK) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

PENK Rabbit Polyclonal Antibody