Mas1 Rabbit Polyclonal Antibody

Mas1 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

Mas1 Polyclonal Antibody

ES8205-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Mas1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

Mas1 Polyclonal Antibody

ES8205-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Mas1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

MAS1 Rabbit pAb

A8132-100ul 100 ul
EUR 308

MAS1 Rabbit pAb

A8132-200ul 200 ul
EUR 459

MAS1 Rabbit pAb

A8132-20ul 20 ul
EUR 183

MAS1 Rabbit pAb

A8132-50ul 50 ul
EUR 223

MAS1 Oncogene (MAS1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

MAS1 Oncogene (MAS1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mas1-like Polyclonal Antibody

ABP53662-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Mas1-like at AA rangle: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of Mas1-like from Human. This Mas1-like antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Mas1-like at AA rangle: 1-80

Mas1-like Polyclonal Antibody

ABP53662-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Mas1-like at AA rangle: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of Mas1-like from Human. This Mas1-like antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Mas1-like at AA rangle: 1-80

Mas1-like Polyclonal Antibody

ABP53662-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Mas1-like at AA rangle: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of Mas1-like from Human. This Mas1-like antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Mas1-like at AA rangle: 1-80

Mas1-like Polyclonal Antibody

ES4661-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Mas1-like from Human. This antibody is tested and validated for IF, WB, ELISA

Mas1-like Polyclonal Antibody

ES4661-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Mas1-like from Human. This antibody is tested and validated for IF, WB, ELISA

MAS1 antibody

70R-1838 100 ug
EUR 377
Description: Rabbit polyclonal MAS1 antibody raised against the middle region of MAS1

MAS1 Antibody

36601-100ul 100ul
EUR 252

MAS1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against MAS1. Recognizes MAS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:2000-5000.IHC:1:200-500

MAS1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MAS1. Recognizes MAS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

MAS1 antibody

70R-7020 50 ug
EUR 467
Description: Rabbit polyclonal MAS1 antibody raised against the middle region of MAS1

MAS1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MAS1. Recognizes MAS1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MAS1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAS1. Recognizes MAS1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

Polyclonal MAS1 Antibody (C-term)

APR03929G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MAS1 (C-term). This antibody is tested and proven to work in the following applications:

MAS1 Polyclonal Antibody, HRP Conjugated

A50367 100 µg
EUR 570.55
Description: fast delivery possible

MAS1 Polyclonal Antibody, FITC Conjugated

A50368 100 µg
EUR 570.55
Description: reagents widely cited

MAS1 Polyclonal Antibody, Biotin Conjugated

A50369 100 µg
EUR 570.55
Description: Ask the seller for details

Polyclonal MAS1 / MAS Antibody (Cytoplasmic Domain)

APR01974G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MAS1 / MAS (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal MAS1 / MAS Antibody (Extracellular Domain)

APR01975G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MAS1 / MAS (Extracellular Domain). This antibody is tested and proven to work in the following applications:

Polyclonal MAS1 / MAS Antibody (C-Terminus)

APR01976G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MAS1 / MAS (C-Terminus). This antibody is tested and proven to work in the following applications:

Anti-Mas1 Antibody

A04678 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Mas1 Antibody (MAS1) detection. Tested with WB, IHC in Human, Mouse, Rat.

MAS1 Conjugated Antibody

C36601 100ul
EUR 397

Anti-MAS1 antibody

STJ11100947 100 µl
EUR 277
Description: This gene encodes a class I seven-transmembrane G-protein-coupled receptor. The encoded protein is a receptor for angiotensin-(1-7) and preferentially couples to the Gq protein, activating the phospholipase C signaling pathway. The encoded protein may play a role in multiple processes including hypotension, smooth muscle relaxation and cardioprotection by mediating the effects of angiotensin-(1-7).

Anti-Mas1 antibody

STJ97400 200 µl
EUR 197
Description: Rabbit polyclonal to Mas1.

Mas1/ Rat Mas1 ELISA Kit

ELI-20534r 96 Tests
EUR 886

Rat MAS1 Oncogene (MAS1) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse MAS1 Oncogene (MAS1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse MAS1 Oncogene (MAS1) ELISA Kit

SEH683Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Mouse MAS1 Oncogene (MAS1) ELISA Kit

SEH683Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Mouse MAS1 Oncogene (MAS1) ELISA Kit

SEH683Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Mouse MAS1 Oncogene (MAS1) ELISA Kit

SEH683Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Mouse MAS1 Oncogene (MAS1) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as MAS1 Oncogene elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse MAS1 Oncogene (MAS1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat MAS1 Oncogene (MAS1) ELISA Kit

SEH683Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Rat MAS1 Oncogene (MAS1) ELISA Kit

SEH683Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Rat MAS1 Oncogene (MAS1) ELISA Kit

SEH683Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Rat MAS1 Oncogene (MAS1) ELISA Kit

SEH683Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Rat MAS1 Oncogene (MAS1) ELISA Kit

  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as MAS1 Oncogene elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat MAS1 Oncogene (MAS1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MAS1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAS1. Recognizes MAS1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MAS1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAS1. Recognizes MAS1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MAS1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAS1. Recognizes MAS1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Mas1-like antibody

STJ94019 200 µl
EUR 197
Description: Rabbit polyclonal to Mas1-like.

MAS1 Blocking Peptide

33R-8095 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MAS1 antibody, catalog no. 70R-1838

MAS1 Blocking Peptide

33R-9598 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MAS1 antibody, catalog no. 70R-7020

MAS1 cloning plasmid

CSB-CL013505HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 978
  • Sequence: atggatgggtcaaacgtgacatcatttgttgttgaggaacccacgaacatctcaactggcaggaacgcctcagtcgggaatgcacatcggcaaatccccatcgtgcactgggtcattatgagcatctccccagtggggtttgttgagaatgggattctcctctggttcctgtgctt
  • Show more
Description: A cloning plasmid for the MAS1 gene.

MAS1 cloning plasmid

CSB-CL013505HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 978
  • Show more
Description: A cloning plasmid for the MAS1 gene.

Proto-Oncogene Mas (MAS1) Antibody

abx027898-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Proto-Oncogene Mas (MAS1) Antibody

abx027898-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Proto-Oncogene Mas (MAS1) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mas1 Rabbit Polyclonal Antibody