Mas1 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

Mas1 Polyclonal Antibody
ABP57206-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of Mas1 from Human, Mouse, Rat. This Mas1 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

MAS1 Polyclonal Antibody
A50366	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

MAS1 Rabbit pAb
A8132-100ul	Abclonal	100 ul	EUR 308

MAS1 Rabbit pAb
A8132-200ul	Abclonal	200 ul	EUR 459

MAS1 Rabbit pAb
A8132-20ul	Abclonal	20 ul	EUR 183

MAS1 Rabbit pAb
A8132-50ul	Abclonal	50 ul	EUR 223

MAS1 Oncogene (MAS1) Antibody
20-abx326994	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

MAS1 Oncogene (MAS1) Antibody
20-abx241564	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Mas1-like Polyclonal Antibody
ES4661-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Mas1-like from Human. This antibody is tested and validated for IF, WB, ELISA

Mas1-like Polyclonal Antibody
ES4661-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Mas1-like from Human. This antibody is tested and validated for IF, WB, ELISA

Mas1-like Polyclonal Antibody
ABP53662-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human Mas1-like at AA rangle: 1-80 Applications tips:
Description: A polyclonal antibody for detection of Mas1-like from Human. This Mas1-like antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Mas1-like at AA rangle: 1-80

Mas1-like Polyclonal Antibody
ABP53662-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human Mas1-like at AA rangle: 1-80 Applications tips:
Description: A polyclonal antibody for detection of Mas1-like from Human. This Mas1-like antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Mas1-like at AA rangle: 1-80

Mas1-like Polyclonal Antibody
ABP53662-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human Mas1-like at AA rangle: 1-80 Applications tips:
Description: A polyclonal antibody for detection of Mas1-like from Human. This Mas1-like antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Mas1-like at AA rangle: 1-80

MAS1 antibody
70R-7020	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal MAS1 antibody raised against the middle region of MAS1

MAS1 Antibody
36601-100ul	SAB	100ul	EUR 252

MAS1 antibody
70R-1838	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal MAS1 antibody raised against the middle region of MAS1

MAS1 Antibody
1-CSB-PA013505ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MAS1. Recognizes MAS1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MAS1 Antibody
1-CSB-PA013505LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAS1. Recognizes MAS1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

MAS1 Antibody
1-CSB-PA080177	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against MAS1. Recognizes MAS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:2000-5000.IHC:1:200-500

MAS1 Antibody
1-CSB-PA084695	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MAS1. Recognizes MAS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

Polyclonal MAS1 Antibody (C-term)
APR03929G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MAS1 (C-term). This antibody is tested and proven to work in the following applications:

MAS1 Polyclonal Antibody, HRP Conjugated
A50367	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

MAS1 Polyclonal Antibody, FITC Conjugated
A50368	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

MAS1 Polyclonal Antibody, Biotin Conjugated
A50369	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Polyclonal MAS1 / MAS Antibody (Cytoplasmic Domain)
APR01974G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MAS1 / MAS (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal MAS1 / MAS Antibody (Extracellular Domain)
APR01975G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MAS1 / MAS (Extracellular Domain). This antibody is tested and proven to work in the following applications:

Polyclonal MAS1 / MAS Antibody (C-Terminus)
APR01976G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MAS1 / MAS (C-Terminus). This antibody is tested and proven to work in the following applications:

MAS1 Conjugated Antibody
C36601	SAB	100ul	EUR 397

Anti-Mas1 Antibody
A04678	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for Mas1 Antibody (MAS1) detection. Tested with WB, IHC in Human, Mouse, Rat.

Anti-Mas1 antibody
STJ97400	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Mas1.

Anti-MAS1 antibody
STJ11100947	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a class I seven-transmembrane G-protein-coupled receptor. The encoded protein is a receptor for angiotensin-(1-7) and preferentially couples to the Gq protein, activating the phospholipase C signaling pathway. The encoded protein may play a role in multiple processes including hypotension, smooth muscle relaxation and cardioprotection by mediating the effects of angiotensin-(1-7).

Mas1/ Rat Mas1 ELISA Kit
ELI-20534r	Lifescience Market	96 Tests	EUR 886

Rat MAS1 Oncogene (MAS1) ELISA Kit
20-abx585155	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse MAS1 Oncogene (MAS1) ELISA Kit
20-abx585156	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse MAS1 Oncogene (MAS1) ELISA Kit
SEH683Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Mouse MAS1 Oncogene (MAS1) ELISA Kit
SEH683Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Mouse MAS1 Oncogene (MAS1) ELISA Kit
SEH683Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Mouse MAS1 Oncogene (MAS1) ELISA Kit
SEH683Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Mouse MAS1 Oncogene (MAS1) ELISA Kit
4-SEH683Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as MAS1 Oncogene elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse MAS1 Oncogene (MAS1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat MAS1 Oncogene (MAS1) ELISA Kit
SEH683Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Rat MAS1 Oncogene (MAS1) ELISA Kit
SEH683Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Rat MAS1 Oncogene (MAS1) ELISA Kit
SEH683Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Rat MAS1 Oncogene (MAS1) ELISA Kit
SEH683Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Rat MAS1 Oncogene (MAS1) ELISA Kit
4-SEH683Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as MAS1 Oncogene elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat MAS1 Oncogene (MAS1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

MAS1 siRNA
20-abx903165	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MAS1 siRNA
20-abx923596	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MAS1 siRNA
20-abx923597	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MAS1 Antibody, HRP conjugated
1-CSB-PA013505LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAS1. Recognizes MAS1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MAS1 Antibody, FITC conjugated
1-CSB-PA013505LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAS1. Recognizes MAS1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MAS1 Antibody, Biotin conjugated
1-CSB-PA013505LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAS1. Recognizes MAS1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Mas1-like antibody
STJ94019	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Mas1-like.

MAS1 cloning plasmid
CSB-CL013505HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 978 Sequence: atggatgggtcaaacgtgacatcatttgttgttgaggaacccacgaacatctcaactggcaggaacgcctcagtcgggaatgcacatcggcaaatccccatcgtgcactgggtcattatgagcatctccccagtggggtttgttgagaatgggattctcctctggttcctgtgctt Show more
Description: A cloning plasmid for the MAS1 gene.

MAS1 cloning plasmid
CSB-CL013505HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 978 Sequence: ATGGATGGGTCAAACGTGACATCATTTGTTGTTGAGGAACCCACGAACATCTCAACTGGCAGGAACGCCTCAGTCGGGAATGCACATCGGCAAATCCCCATCGTGCACTGGGTCATTATGAGCATCTCCCCAGTGGGGTTTGTTGAGAATGGGATTCTCCTCTGGTTCCTGTGCTT Show more
Description: A cloning plasmid for the MAS1 gene.

MAS1 Blocking Peptide
33R-8095	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MAS1 antibody, catalog no. 70R-1838

MAS1 Blocking Peptide
33R-9598	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MAS1 antibody, catalog no. 70R-7020

Proto-Oncogene Mas (MAS1) Antibody
abx027898-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Proto-Oncogene Mas (MAS1) Antibody
abx027898-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Proto-Oncogene Mas (MAS1) Antibody
20-abx320522	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Mas1 Rabbit Polyclonal Antibody