TLR8 Rabbit Polyclonal Antibody

TLR8 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

Polyclonal TLR8 Antibody
AMM05423G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR8 . This antibody is tested and proven to work in the following applications:

Polyclonal TLR8 Antibody
AMM05424G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR8 . This antibody is tested and proven to work in the following applications:

Polyclonal TLR8 Antibody
AMM05425G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR8 . This antibody is tested and proven to work in the following applications:

Polyclonal TLR8 Antibody
AMM05426G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR8 . This antibody is tested and proven to work in the following applications:

Polyclonal TLR8 Antibody
AMM05427G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR8 . This antibody is tested and proven to work in the following applications:

TLR8 Polyclonal Antibody
ABP57216-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR8 from Human, Mouse, Rat. This TLR8 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR8 Polyclonal Antibody
ABP57216-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR8 from Human, Mouse, Rat. This TLR8 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR8 Polyclonal Antibody
ABP57216-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR8 from Human, Mouse, Rat. This TLR8 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR8 Polyclonal Antibody
ES8215-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TLR8 from Human/Mouse/Rat. This antibody is tested and validated for IHC

TLR8 Polyclonal Antibody
ES8215-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TLR8 from Human/Mouse/Rat. This antibody is tested and validated for IHC

TLR8 Rabbit pAb
A12906-100ul 100 ul
EUR 308

TLR8 Rabbit pAb
A12906-200ul 200 ul
EUR 459

TLR8 Rabbit pAb
A12906-20ul 20 ul
EUR 183

TLR8 Rabbit pAb
A12906-50ul 50 ul
EUR 223

TLR8 Rabbit pAb
A1489-100ul 100 ul
EUR 308

TLR8 Rabbit pAb
A1489-200ul 200 ul
EUR 459

TLR8 Rabbit pAb
A1489-20ul 20 ul
EUR 183

TLR8 Rabbit pAb
A1489-50ul 50 ul
EUR 223

Human Toll Like Receptor 8 (TLR8) ELISA Kit
DLR-TLR8-Hu-48T 48T
EUR 498
  • Should the Human Toll Like Receptor 8 (TLR8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Toll Like Receptor 8 (TLR8) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Toll Like Receptor 8 (TLR8) ELISA Kit
DLR-TLR8-Hu-96T 96T
EUR 647
  • Should the Human Toll Like Receptor 8 (TLR8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Toll Like Receptor 8 (TLR8) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Toll Like Receptor 8 (TLR8) ELISA Kit
RDR-TLR8-Hu-48Tests 48 Tests
EUR 522

Human Toll Like Receptor 8 (TLR8) ELISA Kit
RDR-TLR8-Hu-96Tests 96 Tests
EUR 724

Human Toll Like Receptor 8 (TLR8) ELISA Kit
RD-TLR8-Hu-48Tests 48 Tests
EUR 500

Human Toll Like Receptor 8 (TLR8) ELISA Kit
RD-TLR8-Hu-96Tests 96 Tests
EUR 692

Polyclonal TLR8 Antibody (Internal)
AMM05429G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR8 (Internal). This antibody is tested and proven to work in the following applications:

TLR8 Antibody
24229-100ul 100ul
EUR 390

TLR8 Antibody
24232-100ul 100ul
EUR 390

TLR8 Antibody
24233-100ul 100ul
EUR 390

TLR8 antibody
20R-1642 100 ug
EUR 716
Description: Rabbit polyclonal TLR8 antibody

TLR8 antibody
70R-11908 100 ug
EUR 403
Description: Rabbit polyclonal TLR8 antibody

TLR8 antibody
70R-14271 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal TLR8 antibody

TLR8 antibody
70R-14932 200 ug
EUR 543
Description: Affinity purified goat polyclonal TLR8 antibody

TLR8 Antibody
3558R-100
EUR 316

TLR8 Antibody
3558R-30T
EUR 146

TLR8 Antibody
32289-100ul 100ul
EUR 252

TLR8 antibody
10R-6747 100 ul
EUR 705
Description: Mouse monoclonal TLR8 antibody

TLR8 antibody
10R-8042 100 ul
EUR 558
Description: Mouse monoclonal TLR8 antibody

TLR8 Antibody
1-CSB-PA080187
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TLR8. Recognizes TLR8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1:200-500.ELISA:1/10000

TLR8 Antibody
DF6426 200ul
EUR 304
Description: TLR8 Antibody detects endogenous levels of total TLR8.

TLR8 Antibody
1-CSB-PA261777
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR8. Recognizes TLR8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TLR8 Antibody
1-CSB-PA268874
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR8. Recognizes TLR8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

TLR8 Antibody
1-CSB-PA289221
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR8. Recognizes TLR8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

TLR8 Antibody
1-CSB-PA160291
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR8. Recognizes TLR8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TLR8 antibody
70R-9660 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TLR8 antibody

TLR8 Antibody
CSB-PA023607KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against TLR8. Recognizes TLR8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

TLR8 Antibody
CSB-PA023607KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against TLR8. Recognizes TLR8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

TLR8 Antibody
ABD6426 100 ug
EUR 438

Polyclonal TLR8 Antibody (N-Terminus)
AMM05430G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR8 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal Mouse TLR8 Antibody (C-term)
APR11141G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse TLR8 (C-term). This antibody is tested and proven to work in the following applications:

Mouse TLR8 Antibody
abx028486-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mouse TLR8 Antibody
abx028486-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

TLR8 Conjugated Antibody
C32289 100ul
EUR 397

anti- TLR8 antibody
FNab10155 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: Toll-like receptor 8
  • Uniprot ID: Q9NR97
  • Gene ID: 51311
Description: Antibody raised against TLR8

Anti-TLR8 Antibody
PA1734 100ug/vial
EUR 294

Anti-TLR8 Antibody
RP1073 100ug/vial
EUR 294

Anti-TLR8 antibody
STJ25872 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is predominantly expressed in lung and peripheral blood leukocytes, and lies in close proximity to another family member, TLR7, on chromosome X.

Anti-TLR8 antibody
STJ114772 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is predominantly expressed in lung and peripheral blood leukocytes, and lies in close proximity to another family member, TLR7, on chromosome X.

Anti-TLR8 antibody
STJ97410 200 µl
EUR 197
Description: Rabbit polyclonal to TLR8.

TLR8 siRNA
20-abx936903
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TLR8 siRNA
20-abx936904
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Toll Like Receptor 8 (TLR8) Polyclonal Antibody (Rat)
4-PAB991Ra01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR8 ( His519~Ser812)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 8 (TLR8)

TLR8 Blocking Peptide
33R-4922 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TLR8 antibody, catalog no. 70R-9660

TLR8 Blocking Peptide
33R-10802 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TLR8 antibody, catalog no. 70R-11908

TLR8 Blocking Peptide
3558RBP-50
EUR 153

TLR8 Blocking Peptide
DF6426-BP 1mg
EUR 195

TLR8 cloning plasmid
CSB-CL023607HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3126
  • Sequence: ATGGAAAACATGTTCCTTCAGTCGTCAATGCTGACCTGCATTTTCCTGCTAATATCTGGTTCCTGTGAGTTATGCGCCGAAGAAAATTTTTCTAGAAGCTATCCTTGTGATGAGAAAAAGCAAAATGACTCAGTTATTGCAGAGTGCAGCAATCGTCGACTACAGGAAGTTCCCC
  • Show more
Description: A cloning plasmid for the TLR8 gene.

pcDNA3.1-TLR8 Plasmid
PVTB00528-2c 2 ug
EUR 356

Anti-TLR8 (4B4)
YF-MA18471 100 ug
EUR 363
Description: Mouse monoclonal to TLR8

TLR8 Rabbit Polyclonal Antibody