TRIM72 Rabbit Polyclonal Antibody

TRIM72 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

TRIM72 Polyclonal Antibody
ES8180-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRIM72 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
TRIM72 Polyclonal Antibody
ABP57181-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRIM72 from Human, Mouse, Rat. This TRIM72 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
TRIM72 Polyclonal Antibody
ABP57181-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRIM72 from Human, Mouse, Rat. This TRIM72 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
TRIM72 Polyclonal Antibody
ABP57181-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRIM72 from Human, Mouse, Rat. This TRIM72 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
TRIM72/MG53 Polyclonal Antibody
EA151-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TRIM72/MG53 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC
TRIM72/MG53 Polyclonal Antibody
EA151-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRIM72/MG53 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC
TRIM72 antibody
70R-2773 50 ug
EUR 467
Description: Rabbit polyclonal TRIM72 antibody raised against the N terminal of TRIM72
TRIM72 antibody
70R-2774 50 ug
EUR 467
Description: Rabbit polyclonal TRIM72 antibody raised against the middle region of TRIM72
TRIM72 Antibody
1-CSB-PA080146
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TRIM72. Recognizes TRIM72 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000.IHC:1:200-500
Polyclonal TRIM72 Antibody (internal region)
APG00713G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TRIM72 (internal region). This antibody is tested and proven to work in the following applications:
Polyclonal TRIM72 Antibody (C-term)
APR03643G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIM72 (C-term). This antibody is tested and proven to work in the following applications:
Trim72/ Rat Trim72 ELISA Kit
ELI-45760r 96 Tests
EUR 886
Anti-TRIM72 antibody
STJ72398 100 µg
EUR 359
Anti-TRIM72 antibody
STJ97369 200 µl
EUR 197
Description: Rabbit polyclonal to TRIM72.
TRIM72 siRNA
20-abx905794
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRIM72 siRNA
20-abx938124
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRIM72 siRNA
20-abx938125
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-TRIM72
YF-PA23131 50 ug
EUR 363
Description: Mouse polyclonal to TRIM72
anti-TRIM72
YF-PA23132 100 ul
EUR 403
Description: Rabbit polyclonal to TRIM72
anti-TRIM72
YF-PA23133 100 ug
EUR 403
Description: Rabbit polyclonal to TRIM72
Anti-TRIM72, Biotinylated antibody
STJ73502 100 µg
EUR 359
TRIM72 Blocking Peptide
33R-4890 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRIM72 antibody, catalog no. 70R-2774
TRIM72 Blocking Peptide
33R-1646 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRIM72 antibody, catalog no. 70R-2773
TRIM72 cloning plasmid
CSB-CL744394HU-10ug 10ug
EUR 336
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 810
  • Sequence: atgtcggctgcgcccggcctcctgcaccaggagctgtcctgcccgctgtgcctgcagctgttcgacgcgcccgtgacagccgagtgcggccacagtttctgccgcgcctgcctaggccgcgtggccggggagccggcggcggatggcaccgttctctgcccctgctgccaggcccc
  • Show more
Description: A cloning plasmid for the TRIM72 gene.
Anti-TRIM72 (2G1)
YF-MA20166 100 ug
EUR 363
Description: Mouse monoclonal to TRIM72
Anti-TRIM72 (2B8)
YF-MA20167 100 ug
EUR 363
Description: Mouse monoclonal to TRIM72
Anti-TRIM72 (3B5)
YF-MA20168 100 ug
EUR 363
Description: Mouse monoclonal to TRIM72
Mouse TRIM72 shRNA Plasmid
20-abx984057
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TRIM72 shRNA Plasmid
20-abx968355
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat TRIM72 shRNA Plasmid
20-abx990619
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TRIM72 Recombinant Protein (Human)
RP032974 100 ug Ask for price
TRIM72 Recombinant Protein (Rat)
RP234770 100 ug Ask for price
TRIM72 Recombinant Protein (Mouse)
RP181271 100 ug Ask for price

TRIM72 Rabbit Polyclonal Antibody