TRIM72 Rabbit Polyclonal Antibody

TRIM72 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

TRIM72 Polyclonal Antibody
ABP57181-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRIM72 from Human, Mouse, Rat. This TRIM72 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
TRIM72 Polyclonal Antibody
ABP57181-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRIM72 from Human, Mouse, Rat. This TRIM72 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
TRIM72 Polyclonal Antibody
ES8180-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TRIM72 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
TRIM72 Polyclonal Antibody
ES8180-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRIM72 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
TRIM72/MG53 Polyclonal Antibody
EA151-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TRIM72/MG53 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC
TRIM72/MG53 Polyclonal Antibody
EA151-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRIM72/MG53 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC
TRIM72 antibody
70R-2773 50 ug
EUR 467
Description: Rabbit polyclonal TRIM72 antibody raised against the N terminal of TRIM72
TRIM72 antibody
70R-2774 50 ug
EUR 467
Description: Rabbit polyclonal TRIM72 antibody raised against the middle region of TRIM72
TRIM72 Antibody
1-CSB-PA080146
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TRIM72. Recognizes TRIM72 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000.IHC:1:200-500
Polyclonal TRIM72 Antibody (C-term)
APR03643G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIM72 (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal TRIM72 Antibody (internal region)
APG00713G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TRIM72 (internal region). This antibody is tested and proven to work in the following applications:
Trim72/ Rat Trim72 ELISA Kit
ELI-45760r 96 Tests
EUR 886
Anti-TRIM72 antibody
STJ72398 100 µg
EUR 359
Anti-TRIM72 antibody
STJ97369 200 µl
EUR 197
Description: Rabbit polyclonal to TRIM72.
TRIM72 siRNA
20-abx905794
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRIM72 siRNA
20-abx938124
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRIM72 siRNA
20-abx938125
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-TRIM72
YF-PA23131 50 ug
EUR 363
Description: Mouse polyclonal to TRIM72
anti-TRIM72
YF-PA23132 100 ul
EUR 403
Description: Rabbit polyclonal to TRIM72
anti-TRIM72
YF-PA23133 100 ug
EUR 403
Description: Rabbit polyclonal to TRIM72
Anti-TRIM72, Biotinylated antibody
STJ73502 100 µg
EUR 359
TRIM72 Blocking Peptide
33R-4890 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRIM72 antibody, catalog no. 70R-2774
TRIM72 Blocking Peptide
33R-1646 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRIM72 antibody, catalog no. 70R-2773
TRIM72 cloning plasmid
CSB-CL744394HU-10ug 10ug
EUR 336
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 810
  • Sequence: atgtcggctgcgcccggcctcctgcaccaggagctgtcctgcccgctgtgcctgcagctgttcgacgcgcccgtgacagccgagtgcggccacagtttctgccgcgcctgcctaggccgcgtggccggggagccggcggcggatggcaccgttctctgcccctgctgccaggcccc
  • Show more
Description: A cloning plasmid for the TRIM72 gene.
Anti-TRIM72 (2G1)
YF-MA20166 100 ug
EUR 363
Description: Mouse monoclonal to TRIM72
Anti-TRIM72 (2B8)
YF-MA20167 100 ug
EUR 363
Description: Mouse monoclonal to TRIM72
Anti-TRIM72 (3B5)
YF-MA20168 100 ug
EUR 363
Description: Mouse monoclonal to TRIM72
Rat TRIM72 shRNA Plasmid
20-abx990619
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TRIM72 shRNA Plasmid
20-abx968355
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse TRIM72 shRNA Plasmid
20-abx984057
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TRIM72 Recombinant Protein (Rat)
RP234770 100 ug Ask for price
pmCherry-C1-Trim72 Plasmid
PVTB50063-2a 2 ug
EUR 356
TRIM72 Recombinant Protein (Human)
RP032974 100 ug Ask for price

TRIM72 Rabbit Polyclonal Antibody