eIF5B Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

eIF5B Polyclonal Antibody
ABP57085-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the C-terminal region of human eIF5B at AA range: 1020-1100 Applications tips:
Description: A polyclonal antibody for detection of eIF5B from Human, Mouse, Rat. This eIF5B antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human eIF5B at AA range: 1020-1100

eIF5B Polyclonal Antibody
ABP57085-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the C-terminal region of human eIF5B at AA range: 1020-1100 Applications tips:
Description: A polyclonal antibody for detection of eIF5B from Human, Mouse, Rat. This eIF5B antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human eIF5B at AA range: 1020-1100

eIF5B Polyclonal Antibody
ES8084-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against eIF5B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

eIF5B Polyclonal Antibody
ES8084-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against eIF5B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

EIF5B Rabbit pAb
A5888-100ul	Abclonal	100 ul	EUR 308

EIF5B Rabbit pAb
A5888-200ul	Abclonal	200 ul	EUR 459

EIF5B Rabbit pAb
A5888-20ul	Abclonal	20 ul	EUR 183

EIF5B Rabbit pAb
A5888-50ul	Abclonal	50 ul	EUR 223

EIF5B Rabbit pAb
A15123-100ul	Abclonal	100 ul	EUR 308

EIF5B Rabbit pAb
A15123-200ul	Abclonal	200 ul	EUR 459

EIF5B Rabbit pAb
A15123-20ul	Abclonal	20 ul	EUR 183

EIF5B Rabbit pAb
A15123-50ul	Abclonal	50 ul	EUR 223

EIF5B antibody
70R-17066	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal EIF5B antibody

EIF5B antibody
38709-100ul	SAB	100ul	EUR 252

EIF5B Antibody
1-CSB-PA080048	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF5B. Recognizes EIF5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

EIF5B Antibody
DF4055	Affbiotech	200ul	EUR 304
Description: EIF5B Antibody detects endogenous levels of total EIF5B.

EIF5B antibody
70R-35227	Fitzgerald	100 ug	EUR 327
Description: Purified Rabbit polyclonal EIF5B antibody

EIF5B antibody
70R-50733	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal EIF5B antibody

EIF5B Antibody
1-CSB-PA007581GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EIF5B. Recognizes EIF5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

EIF5B Antibody
ABD4055	Lifescience Market	100 ug	EUR 438

Eif5b/ Rat Eif5b ELISA Kit
ELI-07958r	Lifescience Market	96 Tests	EUR 886

EIF5B Conjugated Antibody
C38709	SAB	100ul	EUR 397

Anti-EIF5B Antibody
A30685	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal EIF5B Antibody. Validated in WB and tested in Human, Mouse, Rat.

anti- EIF5B antibody
FNab02730	FN Test	100µg	EUR 548.75
Immunogen: eukaryotic translation initiation factor 5B Uniprot ID: O60841 Gene ID: 9669 Research Area: Metabolism
Description: Antibody raised against EIF5B

Anti-EIF5B antibody
PAab02730	Lifescience Market	100 ug	EUR 386

Anti-EIF5B antibody
STJ116285	St John's Laboratory	100 µl	EUR 277
Description: Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately.

Anti-EIF5B antibody
STJ117317	St John's Laboratory	100 µl	EUR 277
Description: Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately.

Anti-eIF5B antibody
STJ92886	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to eIF5B.

EIF5B siRNA
20-abx901692	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EIF5B siRNA
20-abx915226	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EIF5B siRNA
20-abx915227	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-EIF5B
YF-PA16474	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to EIF5B

anti-EIF5B
YF-PA25392	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to EIF5B

EIF5B Blocking Peptide
DF4055-BP	Affbiotech	1mg	EUR 195

EIF5B Blocking Peptide
20-abx063608	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

EIF5B cloning plasmid
CSB-CL007581HU-10ug	Cusabio	10ug	EUR 1293
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3663 Sequence: atggggaagaaacagaaaaacaagagcgaagacagcaccaaggatgacattgatcttgatgccttggctgcagaaatagaaggagctggtgctgccaaagaacaggagcctcaaaagtcaaaagggaaaaagaaaaaagagaaaaaaaagcaggactttgatgaagatgatatcc Show more
Description: A cloning plasmid for the EIF5B gene.

Anti-EIF5B (3F9)
YF-MA16972	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to EIF5B

Human EIF5B ELISA KIT
ELI-20271h	Lifescience Market	96 Tests	EUR 824

Mouse Eif5b ELISA KIT
ELI-21436m	Lifescience Market	96 Tests	EUR 865

EIF5B ELISA KIT|Human
EF009361	Lifescience Market	96 Tests	EUR 689

Rat EIF5B shRNA Plasmid
20-abx989477	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human EIF5B shRNA Plasmid
20-abx956443	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse EIF5B shRNA Plasmid
20-abx981530	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody
20-abx008399	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody
20-abx004515	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody
abx216136-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody
20-abx112392	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody
20-abx119110	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody
20-abx328778	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody
abx232730-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Eif5b ORF Vector (Rat) (pORF)
ORF066478	ABM	1.0 ug DNA	EUR 506

EIF5B ORF Vector (Human) (pORF)
ORF003502	ABM	1.0 ug DNA	EUR 95

Eif5b ORF Vector (Mouse) (pORF)
ORF043811	ABM	1.0 ug DNA	EUR 506

EIF5B sgRNA CRISPR Lentivector set (Human)
K0672201	ABM	3 x 1.0 ug	EUR 339

Eif5b sgRNA CRISPR Lentivector set (Rat)
K7336901	ABM	3 x 1.0 ug	EUR 339

Eif5b sgRNA CRISPR Lentivector set (Mouse)
K4811301	ABM	3 x 1.0 ug	EUR 339

EIF5B sgRNA CRISPR Lentivector (Human) (Target 1)
K0672202	ABM	1.0 ug DNA	EUR 154

EIF5B sgRNA CRISPR Lentivector (Human) (Target 2)
K0672203	ABM	1.0 ug DNA	EUR 154

EIF5B sgRNA CRISPR Lentivector (Human) (Target 3)
K0672204	ABM	1.0 ug DNA	EUR 154

Eif5b sgRNA CRISPR Lentivector (Rat) (Target 1)
K7336902	ABM	1.0 ug DNA	EUR 154

Eif5b sgRNA CRISPR Lentivector (Rat) (Target 2)
K7336903	ABM	1.0 ug DNA	EUR 154

Eif5b sgRNA CRISPR Lentivector (Rat) (Target 3)
K7336904	ABM	1.0 ug DNA	EUR 154

Eif5b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4811302	ABM	1.0 ug DNA	EUR 154

Eif5b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4811303	ABM	1.0 ug DNA	EUR 154

Eif5b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4811304	ABM	1.0 ug DNA	EUR 154

EIF5B Protein Vector (Mouse) (pPB-C-His)
PV175242	ABM	500 ng	EUR 1065

EIF5B Protein Vector (Mouse) (pPB-N-His)
PV175243	ABM	500 ng	EUR 1065

EIF5B Protein Vector (Mouse) (pPM-C-HA)
PV175244	ABM	500 ng	EUR 1065

EIF5B Protein Vector (Mouse) (pPM-C-His)
PV175245	ABM	500 ng	EUR 1065

EIF5B Protein Vector (Rat) (pPB-C-His)
PV265910	ABM	500 ng	EUR 1191

EIF5B Protein Vector (Rat) (pPB-N-His)
PV265911	ABM	500 ng	EUR 1191

EIF5B Protein Vector (Rat) (pPM-C-HA)
PV265912	ABM	500 ng	EUR 1191

EIF5B Protein Vector (Rat) (pPM-C-His)
PV265913	ABM	500 ng	EUR 1191

EIF5B Protein Vector (Human) (pPB-C-His)
PV014005	ABM	500 ng	EUR 329

EIF5B Protein Vector (Human) (pPB-N-His)
PV014006	ABM	500 ng	EUR 329

EIF5B Protein Vector (Human) (pPM-C-HA)
PV014007	ABM	500 ng	EUR 329

EIF5B Protein Vector (Human) (pPM-C-His)
PV014008	ABM	500 ng	EUR 329

Eif5b 3'UTR GFP Stable Cell Line
TU155745	ABM	1.0 ml	Ask for price

Eif5b 3'UTR Luciferase Stable Cell Line
TU105745	ABM	1.0 ml	Ask for price

Eif5b 3'UTR Luciferase Stable Cell Line
TU203912	ABM	1.0 ml	Ask for price

Eif5b 3'UTR GFP Stable Cell Line
TU253912	ABM	1.0 ml	Ask for price

EIF5B 3'UTR GFP Stable Cell Line
TU056803	ABM	1.0 ml	EUR 1394

EIF5B 3'UTR Luciferase Stable Cell Line
TU006803	ABM	1.0 ml	EUR 1394

EIF5B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV686233	ABM	1.0 ug DNA	EUR 1355

EIF5B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV686237	ABM	1.0 ug DNA	EUR 1355

EIF5B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV686238	ABM	1.0 ug DNA	EUR 1355

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

eIF5B Rabbit Polyclonal Antibody