eIF5B Rabbit Polyclonal Antibody

eIF5B Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

eIF5B Polyclonal Antibody
ES8084-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against eIF5B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
eIF5B Polyclonal Antibody
ABP57085-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human eIF5B at AA range: 1020-1100
  • Applications tips:
Description: A polyclonal antibody for detection of eIF5B from Human, Mouse, Rat. This eIF5B antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human eIF5B at AA range: 1020-1100
eIF5B Polyclonal Antibody
ABP57085-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human eIF5B at AA range: 1020-1100
  • Applications tips:
Description: A polyclonal antibody for detection of eIF5B from Human, Mouse, Rat. This eIF5B antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human eIF5B at AA range: 1020-1100
eIF5B Polyclonal Antibody
ABP57085-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human eIF5B at AA range: 1020-1100
  • Applications tips:
Description: A polyclonal antibody for detection of eIF5B from Human, Mouse, Rat. This eIF5B antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human eIF5B at AA range: 1020-1100
EIF5B Rabbit pAb
A5888-100ul 100 ul
EUR 308
EIF5B Rabbit pAb
A5888-200ul 200 ul
EUR 459
EIF5B Rabbit pAb
A5888-20ul 20 ul
EUR 183
EIF5B Rabbit pAb
A5888-50ul 50 ul
EUR 223
EIF5B Rabbit pAb
A15123-100ul 100 ul
EUR 308
EIF5B Rabbit pAb
A15123-200ul 200 ul
EUR 459
EIF5B Rabbit pAb
A15123-20ul 20 ul
EUR 183
EIF5B Rabbit pAb
A15123-50ul 50 ul
EUR 223
EIF5B antibody
70R-50733 100 ul
EUR 244
Description: Purified Polyclonal EIF5B antibody
EIF5B antibody
70R-35227 100 ug
EUR 327
Description: Purified Rabbit polyclonal EIF5B antibody
EIF5B Antibody
ABD4055 100 ug
EUR 438
EIF5B antibody
38709-100ul 100ul
EUR 252
EIF5B antibody
70R-17066 50 ul
EUR 435
Description: Rabbit polyclonal EIF5B antibody
EIF5B Antibody
DF4055 200ul
EUR 304
Description: EIF5B Antibody detects endogenous levels of total EIF5B.
EIF5B Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EIF5B. Recognizes EIF5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
EIF5B Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF5B. Recognizes EIF5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000
Eif5b/ Rat Eif5b ELISA Kit
ELI-07958r 96 Tests
EUR 886
EIF5B Conjugated Antibody
C38709 100ul
EUR 397
anti- EIF5B antibody
FNab02730 100µg
EUR 548.75
  • Immunogen: eukaryotic translation initiation factor 5B
  • Uniprot ID: O60841
  • Gene ID: 9669
  • Research Area: Metabolism
Description: Antibody raised against EIF5B
Anti-EIF5B Antibody
A30685 100ul
EUR 397
Description: Rabbit Polyclonal EIF5B Antibody. Validated in WB and tested in Human, Mouse, Rat.
Anti-EIF5B antibody
PAab02730 100 ug
EUR 386
Anti-eIF5B antibody
STJ92886 200 µl
EUR 197
Description: Rabbit polyclonal to eIF5B.
Anti-EIF5B antibody
STJ116285 100 µl
EUR 277
Description: Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately.
Anti-EIF5B antibody
STJ117317 100 µl
EUR 277
Description: Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA16474 50 ug
EUR 363
Description: Mouse polyclonal to EIF5B
YF-PA25392 50 ul
EUR 334
Description: Mouse polyclonal to EIF5B
EIF5B cloning plasmid
CSB-CL007581HU-10ug 10ug
EUR 1293
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3663
  • Sequence: atggggaagaaacagaaaaacaagagcgaagacagcaccaaggatgacattgatcttgatgccttggctgcagaaatagaaggagctggtgctgccaaagaacaggagcctcaaaagtcaaaagggaaaaagaaaaaagagaaaaaaaagcaggactttgatgaagatgatatcc
  • Show more
Description: A cloning plasmid for the EIF5B gene.
EIF5B Blocking Peptide
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
EIF5B Blocking Peptide
DF4055-BP 1mg
EUR 195
Anti-EIF5B (3F9)
YF-MA16972 100 ug
EUR 363
Description: Mouse monoclonal to EIF5B
Mouse EIF5B shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat EIF5B shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELI-20271h 96 Tests
EUR 824
Mouse Eif5b ELISA KIT
ELI-21436m 96 Tests
EUR 865
EF009361 96 Tests
EUR 689
Human EIF5B shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody
abx216136-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody
abx232730-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
EIF5B ORF Vector (Human) (pORF)
ORF003502 1.0 ug DNA
EUR 95
Eif5b ORF Vector (Rat) (pORF)
ORF066478 1.0 ug DNA
EUR 506
Eif5b ORF Vector (Mouse) (pORF)
ORF043811 1.0 ug DNA
EUR 506
EIF5B sgRNA CRISPR Lentivector set (Human)
K0672201 3 x 1.0 ug
EUR 339
Eif5b sgRNA CRISPR Lentivector set (Mouse)
K4811301 3 x 1.0 ug
EUR 339
Eif5b sgRNA CRISPR Lentivector set (Rat)
K7336901 3 x 1.0 ug
EUR 339
EIF5B sgRNA CRISPR Lentivector (Human) (Target 1)
K0672202 1.0 ug DNA
EUR 154
EIF5B sgRNA CRISPR Lentivector (Human) (Target 2)
K0672203 1.0 ug DNA
EUR 154
EIF5B sgRNA CRISPR Lentivector (Human) (Target 3)
K0672204 1.0 ug DNA
EUR 154
Eif5b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4811302 1.0 ug DNA
EUR 154
Eif5b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4811303 1.0 ug DNA
EUR 154
Eif5b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4811304 1.0 ug DNA
EUR 154
Eif5b sgRNA CRISPR Lentivector (Rat) (Target 1)
K7336902 1.0 ug DNA
EUR 154
Eif5b sgRNA CRISPR Lentivector (Rat) (Target 2)
K7336903 1.0 ug DNA
EUR 154
Eif5b sgRNA CRISPR Lentivector (Rat) (Target 3)
K7336904 1.0 ug DNA
EUR 154
EIF5B Protein Vector (Mouse) (pPB-C-His)
PV175242 500 ng
EUR 1065
EIF5B Protein Vector (Mouse) (pPB-N-His)
PV175243 500 ng
EUR 1065
EIF5B Protein Vector (Mouse) (pPM-C-HA)
PV175244 500 ng
EUR 1065
EIF5B Protein Vector (Mouse) (pPM-C-His)
PV175245 500 ng
EUR 1065
EIF5B Protein Vector (Human) (pPB-C-His)
PV014005 500 ng
EUR 329
EIF5B Protein Vector (Human) (pPB-N-His)
PV014006 500 ng
EUR 329
EIF5B Protein Vector (Human) (pPM-C-HA)
PV014007 500 ng
EUR 329
EIF5B Protein Vector (Human) (pPM-C-His)
PV014008 500 ng
EUR 329
EIF5B Protein Vector (Rat) (pPB-C-His)
PV265910 500 ng
EUR 1191
EIF5B Protein Vector (Rat) (pPB-N-His)
PV265911 500 ng
EUR 1191
EIF5B Protein Vector (Rat) (pPM-C-HA)
PV265912 500 ng
EUR 1191
EIF5B Protein Vector (Rat) (pPM-C-His)
PV265913 500 ng
EUR 1191
Eif5b 3'UTR Luciferase Stable Cell Line
TU203912 1.0 ml Ask for price
Eif5b 3'UTR GFP Stable Cell Line
TU155745 1.0 ml Ask for price
EIF5B 3'UTR Luciferase Stable Cell Line
TU006803 1.0 ml
EUR 1394
Eif5b 3'UTR Luciferase Stable Cell Line
TU105745 1.0 ml Ask for price
EIF5B 3'UTR GFP Stable Cell Line
TU056803 1.0 ml
EUR 1394
Eif5b 3'UTR GFP Stable Cell Line
TU253912 1.0 ml Ask for price
EIF5B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV686233 1.0 ug DNA
EUR 1355
EIF5B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV686237 1.0 ug DNA
EUR 1355
EIF5B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV686238 1.0 ug DNA
EUR 1355
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

eIF5B Rabbit Polyclonal Antibody