CALHM1 Rabbit Polyclonal Antibody

CALHM1 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

CALHM1 Polyclonal Antibody
31366-50ul 50ul
EUR 187
CALHM1 Polyclonal Antibody
EA189-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CALHM1 from Human/ Rat. This antibody is tested and validated for WB, ELISA, IHC
CALHM1 Polyclonal Antibody
EA189-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CALHM1 from Human/ Rat. This antibody is tested and validated for WB, ELISA, IHC
Polyclonal CALHM1 Antibody
APG02335G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALHM1 . This antibody is tested and proven to work in the following applications:
CALHM1 Polyclonal Antibody
ABP57219-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CALHM1 from Human, Rat. This CALHM1 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide
CALHM1 Polyclonal Antibody
ABP57219-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CALHM1 from Human, Rat. This CALHM1 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide
CALHM1 Polyclonal Antibody
ABP57219-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CALHM1 from Human, Rat. This CALHM1 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide
CALHM1 Polyclonal Antibody
ES8218-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CALHM1 from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC
CALHM1 Polyclonal Antibody
ES8218-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CALHM1 from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC
CALHM1 Rabbit pAb
A7858-100ul 100 ul
EUR 308
CALHM1 Rabbit pAb
A7858-200ul 200 ul
EUR 459
CALHM1 Rabbit pAb
A7858-20ul 20 ul
EUR 183
CALHM1 Rabbit pAb
A7858-50ul 50 ul
EUR 223
CALHM1 Polyclonal Conjugated Antibody
C31366 100ul
EUR 397
CALHM1 Antibody
25049-100ul 100ul
EUR 390
CALHM1 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against CALHM1. Recognizes CALHM1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:500-1000.IHC:1:200-500
CALHM1 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CALHM1. Recognizes CALHM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
CALHM1 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CALHM1. Recognizes CALHM1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000
Anti-CALHM1 Antibody
A03599 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CALHM1 Antibody (CALHM1) detection. Tested with WB, IHC in Human, Rat.
anti- CALHM1 antibody
FNab01200 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: calcium homeostasis modulator 1
  • Uniprot ID: Q8IU99
  • Gene ID: 255022
  • Research Area: Neuroscience
Description: Antibody raised against CALHM1
Anti-CALHM1 antibody
PAab01200 100 ug
EUR 355
Anti-CALHM1 antibody
STJ110168 100 µl
EUR 277
Description: This gene encodes a calcium channel that plays a role in processing of amyloid-beta precursor protein. A polymorphism at this locus has been reported to be associated with susceptibility to late-onset Alzheimer's disease in some populations, but the pathogenicity of this polymorphism is unclear.
Anti-CALHM1 antibody
STJ97413 200 µl
EUR 197
Description: Rabbit polyclonal to CALHM1.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CALHM1 cloning plasmid
CSB-CL808532HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1041
  • Sequence: atgatggacaagttccggatgatcttccagttcctgcagtccaaccaggagtccttcatgaatggcatctgtggcatcatggccctggccagtgcccagatgtactcggccttcgacttcaactgcccctgcctgccgggctacaatgcggcctacagcgcgggcatcctgctgg
  • Show more
Description: A cloning plasmid for the CALHM1 gene.
EF008342 96 Tests
EUR 689
Human CALHM1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse CALHM1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
CALHM1 Recombinant Protein (Human)
RP005467 100 ug Ask for price
CALHM1 Recombinant Protein (Rat)
RP192914 100 ug Ask for price
CALHM1 Recombinant Protein (Mouse)
RP120824 100 ug Ask for price
Rabbit Calcium homeostasis modulator protein 1(CALHM1) ELISA kit
E04C1320-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium homeostasis modulator protein 1(CALHM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Calcium homeostasis modulator protein 1(CALHM1) ELISA kit
E04C1320-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium homeostasis modulator protein 1(CALHM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Calcium homeostasis modulator protein 1(CALHM1) ELISA kit
E04C1320-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium homeostasis modulator protein 1(CALHM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Calcium Homeostasis Modulator Protein 1 (CALHM1) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Calcium Homeostasis Modulator Protein 1 (CALHM1) Antibody
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Calcium Homeostasis Modulator Protein 1 (CALHM1) Antibody
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Calcium Homeostasis Modulator Protein 1 (CALHM1) Antibody
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Calcium Homeostasis Modulator Protein 1 (CALHM1) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Calcium Homeostasis Modulator Protein 1 (CALHM1) Antibody
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Calcium Homeostasis Modulator Protein 1 (CALHM1) Antibody
abx231200-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Calhm1 ORF Vector (Rat) (pORF)
ORF064306 1.0 ug DNA
EUR 506
CALHM1 ORF Vector (Human) (pORF)
ORF001823 1.0 ug DNA
EUR 95
Calhm1 ORF Vector (Mouse) (pORF)
ORF040276 1.0 ug DNA
EUR 506
CALHM1 sgRNA CRISPR Lentivector set (Human)
K0355101 3 x 1.0 ug
EUR 339
Calhm1 sgRNA CRISPR Lentivector set (Rat)
K6111101 3 x 1.0 ug
EUR 339
Calhm1 sgRNA CRISPR Lentivector set (Mouse)
K3025901 3 x 1.0 ug
EUR 339
CALHM1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0355102 1.0 ug DNA
EUR 154
CALHM1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0355103 1.0 ug DNA
EUR 154
CALHM1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0355104 1.0 ug DNA
EUR 154
Calhm1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6111102 1.0 ug DNA
EUR 154
Calhm1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6111103 1.0 ug DNA
EUR 154
Calhm1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6111104 1.0 ug DNA
EUR 154
Calhm1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3025902 1.0 ug DNA
EUR 154
Calhm1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3025903 1.0 ug DNA
EUR 154
Calhm1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3025904 1.0 ug DNA
EUR 154
CALHM1 Protein Vector (Mouse) (pPB-C-His)
PV161102 500 ng
EUR 603
CALHM1 Protein Vector (Mouse) (pPB-N-His)
PV161103 500 ng
EUR 603
CALHM1 Protein Vector (Mouse) (pPM-C-HA)
PV161104 500 ng
EUR 603
CALHM1 Protein Vector (Mouse) (pPM-C-His)
PV161105 500 ng
EUR 603
CALHM1 Protein Vector (Rat) (pPB-C-His)
PV257222 500 ng
EUR 603
CALHM1 Protein Vector (Rat) (pPB-N-His)
PV257223 500 ng
EUR 603
CALHM1 Protein Vector (Rat) (pPM-C-HA)
PV257224 500 ng
EUR 603
CALHM1 Protein Vector (Rat) (pPM-C-His)
PV257225 500 ng
EUR 603
CALHM1 Protein Vector (Human) (pPB-C-His)
PV007289 500 ng
EUR 329
CALHM1 Protein Vector (Human) (pPB-N-His)
PV007290 500 ng
EUR 329
CALHM1 Protein Vector (Human) (pPM-C-HA)
PV007291 500 ng
EUR 329
CALHM1 Protein Vector (Human) (pPM-C-His)
PV007292 500 ng
EUR 329
Calhm1 3'UTR GFP Stable Cell Line
TU153054 1.0 ml Ask for price
Calhm1 3'UTR Luciferase Stable Cell Line
TU103054 1.0 ml Ask for price

CALHM1 Rabbit Polyclonal Antibody