Arnt 2 Rabbit Polyclonal Antibody

Arnt 2 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

Arnt 2 Polyclonal Antibody
ABP57126-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human Arnt 2 at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of Arnt 2 from Human, Mouse, Rat. This Arnt 2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Arnt 2 at AA range: 40-120

Arnt 2 Polyclonal Antibody
ES8125-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Arnt 2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Arnt 2 Polyclonal Antibody
ES8125-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Arnt 2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Anti-Arnt 2 antibody
STJ91699 200 µl
EUR 197
Description: Rabbit polyclonal to Arnt 2.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
DLR-ARNT-Hu-48T 48T
EUR 517
  • Should the Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
DLR-ARNT-Hu-96T 96T
EUR 673
  • Should the Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
DLR-ARNT-Mu-48T 48T
EUR 527
  • Should the Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in samples from tissue homogenates or other biological fluids.

Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
DLR-ARNT-Mu-96T 96T
EUR 688
  • Should the Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in samples from tissue homogenates or other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
RDR-ARNT-Hu-48Tests 48 Tests
EUR 544

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
RDR-ARNT-Hu-96Tests 96 Tests
EUR 756

Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
RDR-ARNT-Mu-48Tests 48 Tests
EUR 557

Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
RDR-ARNT-Mu-96Tests 96 Tests
EUR 774

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
RD-ARNT-Hu-48Tests 48 Tests
EUR 521

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
RD-ARNT-Hu-96Tests 96 Tests
EUR 723

Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
RD-ARNT-Mu-48Tests 48 Tests
EUR 533

Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
RD-ARNT-Mu-96Tests 96 Tests
EUR 740

HIF1B/ARNT Rabbit pAb
A0972-100ul 100 ul
EUR 308

HIF1B/ARNT Rabbit pAb
A0972-200ul 200 ul
EUR 459

HIF1B/ARNT Rabbit pAb
A0972-20ul 20 ul
EUR 183

HIF1B/ARNT Rabbit pAb
A0972-50ul 50 ul
EUR 223

HIF1B/ARNT Rabbit pAb
A14705-100ul 100 ul
EUR 308

HIF1B/ARNT Rabbit pAb
A14705-200ul 200 ul
EUR 459

HIF1B/ARNT Rabbit pAb
A14705-20ul 20 ul
EUR 183

HIF1B/ARNT Rabbit pAb
A14705-50ul 50 ul
EUR 223

HIF1B/ARNT Rabbit mAb
A19532-100ul 100 ul
EUR 410

HIF1B/ARNT Rabbit mAb
A19532-200ul 200 ul
EUR 571

HIF1B/ARNT Rabbit mAb
A19532-20ul 20 ul
EUR 221

HIF1B/ARNT Rabbit mAb
A19532-50ul 50 ul
EUR 287

HIF1B/ARNT Rabbit pAb
A16990-100ul 100 ul
EUR 308

HIF1B/ARNT Rabbit pAb
A16990-200ul 200 ul
EUR 459

HIF1B/ARNT Rabbit pAb
A16990-20ul 20 ul
EUR 183

HIF1B/ARNT Rabbit pAb
A16990-50ul 50 ul
EUR 223

HIF-1 ?/ARNT Polyclonal Antibody
EA159-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HIF-1 ?/ARNT from Rat/ Mouse/ Human. This antibody is tested and validated for WB, ELISA, IHC

HIF-1 ?/ARNT Polyclonal Antibody
EA159-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HIF-1 ?/ARNT from Rat/ Mouse/ Human. This antibody is tested and validated for WB, ELISA, IHC

HIF-1?/ARNT Polyclonal Antibody
EA167-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HIF-1?/ARNT from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC

HIF-1?/ARNT Polyclonal Antibody
EA167-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HIF-1?/ARNT from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC

ARNT antibody
70R-21450 50 ul
EUR 435
Description: Rabbit polyclonal ARNT antibody

ARNT antibody
70R-31659 100 ug
EUR 327
Description: Rabbit polyclonal ARNT antibody

ARNT Antibody
33731-100ul 100ul
EUR 252

ARNT Antibody
33731-50ul 50ul
EUR 187

ARNT Antibody
32101-100ul 100ul
EUR 252

ARNT antibody
10R-3373 100 ul
EUR 726
Description: Mouse monoclonal ARNT antibody

ARNT antibody
10R-3374 100 ul
EUR 691
Description: Mouse monoclonal ARNT antibody

ARNT antibody
10R-3377 100 ul
EUR 691
Description: Mouse monoclonal ARNT antibody

ARNT Antibody
1-CSB-PA002121GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ARNT. Recognizes ARNT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ARNT Antibody
1-CSB-PA002907
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ARNT. Recognizes ARNT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

ARNT Antibody
1-CSB-PA080154
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against ARNT. Recognizes ARNT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500

ARNT Antibody
DF3136 200ul
EUR 304
Description: ARNT Antibody detects endogenous levels of total ARNT.

ARNT Antibody
DF6154 200ul
EUR 304
Description: ARNT Antibody detects endogenous levels of total ARNT.

ARNT Antibody
CSB-PA174700-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ARNT. Recognizes ARNT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

ARNT Antibody
CSB-PA174700-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ARNT. Recognizes ARNT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Arnt antibody
70R-7856 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Arnt antibody

Arnt antibody
70R-7857 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Arnt antibody

ARNT Antibody
ABD3136 100 ug
EUR 438

ARNT Antibody
ABD6154 100 ug
EUR 438

Rabbit Polyclonal Antibody to Human Topoisomerase I (Rabbit Serum)
TG2012-2 250 ul
EUR 380

Anti-Bcl-2 Rabbit Monoclonal Antibody
M00040-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Bcl-2 Antibody. Validated in IF, WB and tested in Human, Mouse.

ARNT Conjugated Antibody
C32101 100ul
EUR 397

ARNT,HIF1B Antibody
abx230594-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Anti-ARNT antibody
STJ116905 100 µl
EUR 277
Description: This gene encodes a protein containing a basic helix-loop-helix domain and two characteristic PAS domains along with a PAC domain. The encoded protein binds to ligand-bound aryl hydrocarbon receptor and aids in the movement of this complex to the nucleus, where it promotes the expression of genes involved in xenobiotic metabolism. This protein is also a co-factor for transcriptional regulation by hypoxia-inducible factor 1. Chromosomal translocation of this locus with the ETV6 (ets variant 6) gene on chromosome 12 have been described in leukemias. Alternative splicing results in multiple transcript variants.

Anti-ARNT antibody
STJ22685 100 µl
EUR 277
Description: This gene encodes a protein containing a basic helix-loop-helix domain and two characteristic PAS domains along with a PAC domain. The encoded protein binds to ligand-bound aryl hydrocarbon receptor and aids in the movement of this complex to the nucleus, where it promotes the expression of genes involved in xenobiotic metabolism. This protein is also a co-factor for transcriptional regulation by hypoxia-inducible factor 1. Chromosomal translocation of this locus with the ETV6 (ets variant 6) gene on chromosome 12 have been described in leukemias. Alternative splicing results in multiple transcript variants.

Arnt/ Rat Arnt ELISA Kit
ELI-07321r 96 Tests
EUR 886

Polyclonal ARNT (aa558-570) Antibody (internal region)
APG01987G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ARNT (aa558-570) (internal region). This antibody is tested and proven to work in the following applications:

Anti-COX-2 Rabbit Monoclonal Antibody, Clone#RM348
M00084-2 100uL
EUR 397
Description: Anti-COX-2 Rabbit Monoclonal Antibody, Clone#RM348 tested in WB, IHC, reactive to Human

ARNT siRNA
20-abx900450
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARNT siRNA
20-abx908189
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARNT siRNA
20-abx908190
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ARNT
YF-PA10337 50 ug
EUR 363
Description: Mouse polyclonal to ARNT

anti- ARNT,HIF1B antibody
FNab00594 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:2000
  • Immunogen: aryl hydrocarbon receptor nuclear translocator
  • Uniprot ID: P27540
  • Gene ID: 405
  • Research Area: Epigenetics, Cardiovascular, Metabolism, Signal Transduction
Description: Antibody raised against ARNT,HIF1B

Anti-ARNT,HIF1B antibody
PAab00594 100 ug
EUR 386

Anti-HIF1B/ARNT antibody
STJ119290 100 µl
EUR 277
Description: This gene encodes a protein containing a basic helix-loop-helix domain and two characteristic PAS domains along with a PAC domain. The encoded protein binds to ligand-bound aryl hydrocarbon receptor and aids in the movement of this complex to the nucleus, where it promotes the expression of genes involved in xenobiotic metabolism. This protein is also a co-factor for transcriptional regulation by hypoxia-inducible factor 1. Chromosomal translocation of this locus with the ETV6 (ets variant 6) gene on chromosome 12 have been described in leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013]

Polyclonal ARNT / HIF-1-Beta Antibody (aa528-544)
APG01989G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ARNT / HIF-1-Beta (aa528-544). This antibody is tested and proven to work in the following applications:

Aryl hydrocarbon receptor nuclear translocator (ARNT) polyclonal antibody
ABP-PAB-10487 100 ug Ask for price
    • Product line: Genetic Disease Markers
    • Brand:

Rabbit Anti-Human ARNT monoclonal antibody, clone TU16-36
CABT-L680 100 ul
EUR 777

HIF-1 ?/ARNT Monoclonal Antibody
EM1242-100ul 100ul
EUR 279
Description: A Mouse Monoclonal antibody against HIF-1 ?/ARNT from Mouse. This antibody is tested and validated for WB, ELISA, IHC

HIF-1 ?/ARNT Monoclonal Antibody
EM1242-50ul 50ul
EUR 207
Description: A Mouse Monoclonal antibody against HIF-1 ?/ARNT from Mouse. This antibody is tested and validated for WB, ELISA, IHC

Anti-HIF1 beta/ARNT Antibody
PB9129 100ug/vial
EUR 294

Anti-ARNT (aa558-570) antibody
STJ73329 100 µg
EUR 359

Anti-ARNT (aa69-82) antibody
STJ73330 100 µg
EUR 359

Arnt Blocking Peptide
33R-8649 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Arnt antibody, catalog no. 70R-7857

ARNT Blocking Peptide
DF3136-BP 1mg
EUR 195

ARNT Blocking Peptide
DF6154-BP 1mg
EUR 195

ARNT cloning plasmid
CSB-CL002121HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1251
  • Sequence: atggcggcgactactgccaaccccgaaatgacatcagatgtaccatcactgggtccagccattgcctctggaaactctggacctggaattcaaggtggaggagccattgtccagagggctattaagcggcgaccagggctggattttgatgatgatggagaagggaacagtaaat
  • Show more
Description: A cloning plasmid for the ARNT gene.

Anti-ARNT (3D10)
YF-MA10060 100 ug
EUR 363
Description: Mouse monoclonal to ARNT

Anti-ARNT (1F12)
YF-MA12005 50 ug
EUR 363
Description: Mouse monoclonal to ARNT

Anti-ARNT (1F12)
YF-MA12006 200 ul
EUR 363
Description: Mouse monoclonal to ARNT

Anti-p53 Rabbit Monoclonal Antibody
M00001-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal p53 Antibody. Validated in ICC/IF, WB and tested in Human.

Anti-PTEN Rabbit Monoclonal Antibody
M00006-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal PTEN Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-STAT3 Rabbit Monoclonal Antibody
M00007-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal STAT3 Antibody. Validated in IP, IF, WB and tested in Human.

Anti-Rb Rabbit Monoclonal Antibody
M00039-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Rb Antibody. Validated in IP, IF, WB and tested in Human, Mouse.

Anti-Ras Rabbit Monoclonal Antibody
M00099-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Ras Antibody. Validated in Flow Cytometry, IP, WB and tested in Human, Mouse, Rat.

Anti-ERK1 Rabbit Monoclonal Antibody
M00104-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal ERK1 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-p21 Rabbit Monoclonal Antibody
M00145-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal p21 Antibody. Validated in IF, ICC, WB and tested in Human, Mouse, Rat.

Anti-p38 Rabbit Monoclonal Antibody
M00176-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal p38 Antibody. Validated in ChIP, IP, IF, WB and tested in Human, Mouse, Rat.

Anti-Rho Rabbit Monoclonal Antibody
M00207-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Rho Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-GFAP Rabbit Monoclonal Antibody
M00213-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal GFAP Antibody. Validated in IF, IHC, WB and tested in Human, Rat.

Anti-LRRK2 Rabbit Monoclonal Antibody
M00221-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal LRRK2 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat.

Anti-MiTF Rabbit Monoclonal Antibody
M00269-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal MiTF Antibody. Validated in WB and tested in Human, Mouse, Rat.

Arnt 2 Rabbit Polyclonal Antibody