BATF3 Rabbit Polyclonal Antibody

BATF3 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

BATF3 Polyclonal Antibody
ABP57435-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human BATF3
  • Applications tips:
Description: A polyclonal antibody for detection of BATF3 from Human, Mouse, Rat. This BATF3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human BATF3

BATF3 Polyclonal Antibody
ABP57435-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human BATF3
  • Applications tips:
Description: A polyclonal antibody for detection of BATF3 from Human, Mouse, Rat. This BATF3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human BATF3

BATF3 Polyclonal Antibody
ES8428-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against BATF3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

BATF3 Polyclonal Antibody
ES8428-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against BATF3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

BATF3 Rabbit pAb
A14906-100ul 100 ul
EUR 308

BATF3 Rabbit pAb
A14906-200ul 200 ul
EUR 459

BATF3 Rabbit pAb
A14906-20ul 20 ul
EUR 183

BATF3 Rabbit pAb
A14906-50ul 50 ul
EUR 223

BATF3 Polyclonal Conjugated Antibody
C28753 100ul
EUR 397

Batf3 Antibody
1-CSB-PA002572LA01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Batf3. Recognizes Batf3 from Rat. This antibody is Unconjugated. Tested in the following application: ELISA

BATF3 Antibody
1-CSB-PA882082LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BATF3. Recognizes BATF3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

BATF3 Antibody
1-CSB-PA344549
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BATF3. Recognizes BATF3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC-p:1:100-1:300.ELISA:1/10000

Batf3 Polyclonal Antibody, HRP Conjugated
A50086 100 µg
EUR 570.55
Description: fast delivery possible

Batf3 Polyclonal Antibody, FITC Conjugated
A50087 100 µg
EUR 570.55
Description: reagents widely cited

Batf3 Polyclonal Antibody, Biotin Conjugated
A50088 100 µg
EUR 570.55
Description: Ask the seller for details

Anti-BATF3 antibody
STJ117106 100 µl
EUR 277
Description: This gene encodes a member of the basic leucine zipper protein family. The encoded protein functions as a transcriptional repressor when heterodimerizing with JUN. The protein may play a role in repression of interleukin-2 and matrix metalloproteinase-1 transcription.

Anti-BATF3 antibody
STJ97689 200 µl
EUR 197
Description: Rabbit polyclonal to BATF3.

BATF3 siRNA
20-abx900597
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BATF3 siRNA
20-abx908897
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BATF3 siRNA
20-abx908898
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-BATF3
YF-PA19736 50 ug
EUR 363
Description: Mouse polyclonal to BATF3

anti-BATF3
YF-PA26335 50 ul
EUR 334
Description: Mouse polyclonal to BATF3

Batf3 Antibody, HRP conjugated
1-CSB-PA002572LB01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Batf3. Recognizes Batf3 from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

Batf3 Antibody, FITC conjugated
1-CSB-PA002572LC01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Batf3. Recognizes Batf3 from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

Batf3 Antibody, Biotin conjugated
1-CSB-PA002572LD01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Batf3. Recognizes Batf3 from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

BATF3 Antibody, HRP conjugated
1-CSB-PA882082LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BATF3. Recognizes BATF3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BATF3 Antibody, FITC conjugated
1-CSB-PA882082LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BATF3. Recognizes BATF3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BATF3 Antibody, Biotin conjugated
1-CSB-PA882082LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BATF3. Recognizes BATF3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-BATF3/Snft Antibody
A01957 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for BATF3 Antibody (BATF3) detection.tested for IHC, WB in Human, Mouse, Rat.

BATF3 Blocking Peptide
20-abx061956
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

BATF3 cloning plasmid
CSB-CL882082HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 384
  • Sequence: atgtcgcaagggctcccggccgccggcagcgtcctgcagaggagcgtcgcggcgcccgggaaccagccgcagccgcagccgcagcagcagagccctgaggatgatgacaggaaggtccgaaggagagaaaaaaaccgagttgctgctcagagaagtcggaagaagcagacccagaa
  • Show more
Description: A cloning plasmid for the BATF3 gene.

Anti-BATF3 (3H1)
YF-MA20561 100 ug
EUR 363
Description: Mouse monoclonal to BATF3

BATF3 protein (His tag)
80R-3698 20 ug
EUR 327
Description: Purified recombinant BATF3 protein (His tag)

Rat BATF3 shRNA Plasmid
20-abx986060
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human BATF3 shRNA Plasmid
20-abx960717
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse BATF3 shRNA Plasmid
20-abx983818
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

BATF3 Recombinant Protein (Human)
RP036928 100 ug Ask for price

BATF3 Recombinant Protein (Rat)
RP191891 100 ug Ask for price

BATF3 Recombinant Protein (Mouse)
RP118760 100 ug Ask for price

Batf3 ORF Vector (Rat) (pORF)
ORF063965 1.0 ug DNA
EUR 506

BATF3 ORF Vector (Human) (pORF)
ORF012310 1.0 ug DNA
EUR 354

Batf3 ORF Vector (Mouse) (pORF)
ORF039588 1.0 ug DNA
EUR 506

Batf3 sgRNA CRISPR Lentivector set (Mouse)
K4842601 3 x 1.0 ug
EUR 339

Batf3 sgRNA CRISPR Lentivector set (Rat)
K6920701 3 x 1.0 ug
EUR 339

BATF3 sgRNA CRISPR Lentivector set (Human)
K0171201 3 x 1.0 ug
EUR 339

Rabbit Basic leucine zipper transcriptional factor ATF like 3(BATF3) ELISA kit
E04B0752-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Basic leucine zipper transcriptional factor ATF like 3(BATF3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Basic leucine zipper transcriptional factor ATF like 3(BATF3) ELISA kit
E04B0752-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Basic leucine zipper transcriptional factor ATF like 3(BATF3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Basic leucine zipper transcriptional factor ATF like 3(BATF3) ELISA kit
E04B0752-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Basic leucine zipper transcriptional factor ATF like 3(BATF3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Batf3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4842602 1.0 ug DNA
EUR 154

Batf3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4842603 1.0 ug DNA
EUR 154

Batf3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4842604 1.0 ug DNA
EUR 154

Batf3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6920702 1.0 ug DNA
EUR 154

Batf3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6920703 1.0 ug DNA
EUR 154

Batf3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6920704 1.0 ug DNA
EUR 154

BATF3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0171202 1.0 ug DNA
EUR 154

BATF3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0171203 1.0 ug DNA
EUR 154

BATF3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0171204 1.0 ug DNA
EUR 154

BATF3 Protein Vector (Mouse) (pPB-C-His)
PV158350 500 ng
EUR 603

BATF3 Protein Vector (Mouse) (pPB-N-His)
PV158351 500 ng
EUR 603

BATF3 Protein Vector (Mouse) (pPM-C-HA)
PV158352 500 ng
EUR 603

BATF3 Protein Vector (Mouse) (pPM-C-His)
PV158353 500 ng
EUR 603

BATF3 Protein Vector (Rat) (pPB-C-His)
PV255858 500 ng
EUR 603

BATF3 Protein Vector (Rat) (pPB-N-His)
PV255859 500 ng
EUR 603

BATF3 Protein Vector (Rat) (pPM-C-HA)
PV255860 500 ng
EUR 603

BATF3 Protein Vector (Rat) (pPM-C-His)
PV255861 500 ng
EUR 603

BATF3 Protein Vector (Human) (pPB-His-MBP)
PV326298 500 ng
EUR 481

BATF3 Protein Vector (Human) (pPB-His-GST)
PV326299 500 ng
EUR 481

BATF3 Protein Vector (Human) (pPB-C-His)
PV049237 500 ng
EUR 481

BATF3 Protein Vector (Human) (pPB-N-His)
PV049238 500 ng
EUR 481

BATF3 Protein Vector (Human) (pPM-C-HA)
PV049239 500 ng
EUR 481

BATF3 Protein Vector (Human) (pPM-C-His)
PV049240 500 ng
EUR 481

Recombinant Rat Batf3 Protein, His, E.coli-100ug
QP5704-ec-100ug 100ug
EUR 571

Recombinant Rat Batf3 Protein, His, E.coli-10ug
QP5704-ec-10ug 10ug
EUR 272

Recombinant Rat Batf3 Protein, His, E.coli-1mg
QP5704-ec-1mg 1mg
EUR 2303

Recombinant Rat Batf3 Protein, His, E.coli-200ug
QP5704-ec-200ug 200ug
EUR 898

Recombinant Rat Batf3 Protein, His, E.coli-500ug
QP5704-ec-500ug 500ug
EUR 1514

Recombinant Rat Batf3 Protein, His, E.coli-50ug
QP5704-ec-50ug 50ug
EUR 362

Recombinant Rat Batf3 Protein, His, Yeast-100ug
QP5704-ye-100ug 100ug
EUR 571

Recombinant Rat Batf3 Protein, His, Yeast-10ug
QP5704-ye-10ug 10ug
EUR 272

Recombinant Rat Batf3 Protein, His, Yeast-1mg
QP5704-ye-1mg 1mg
EUR 2303

Recombinant Rat Batf3 Protein, His, Yeast-200ug
QP5704-ye-200ug 200ug
EUR 898

Recombinant Rat Batf3 Protein, His, Yeast-500ug
QP5704-ye-500ug 500ug
EUR 1505

Recombinant Rat Batf3 Protein, His, Yeast-50ug
QP5704-ye-50ug 50ug
EUR 354

Recombinant Human BATF3 Protein, His, E.coli-100ug
QP11129-100ug 100ug
EUR 1261

Recombinant Human BATF3 Protein, His, E.coli-10ug
QP11129-10ug 10ug
EUR 201

Recombinant Human BATF3 Protein, His, E.coli-2ug
QP11129-2ug 2ug
EUR 155

Batf3 3'UTR GFP Stable Cell Line
TU152535 1.0 ml Ask for price

Batf3 3'UTR Luciferase Stable Cell Line
TU102535 1.0 ml Ask for price

Batf3 3'UTR Luciferase Stable Cell Line
TU201234 1.0 ml Ask for price

Batf3 3'UTR GFP Stable Cell Line
TU251234 1.0 ml Ask for price

BATF3 3'UTR GFP Stable Cell Line
TU051655 1.0 ml
EUR 1394

BATF3 3'UTR Luciferase Stable Cell Line
TU001655 1.0 ml
EUR 1394

Basic Leucine Zipper ATF-Like Transcription Factor 3 (BATF3) Antibody
20-abx141258
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Basic Leucine Zipper ATF-Like Transcription Factor 3 (BATF3) Antibody
20-abx319639
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Basic Leucine Zipper ATF-Like Transcription Factor 3 (BATF3) Antibody
20-abx329746
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Basic Leucine Zipper ATF-Like Transcription Factor 3 (BATF3) Antibody
20-abx301043
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

BATF3 Rabbit Polyclonal Antibody